Introductory Genetics

How genes work

What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule (usually a protein) DNA Protein …GAATTCTAATCTCCCTCTC AACCCTACAGTCACCCATTT GGTATATTAAAGATGTGTTG TCTACTGTCTAGTATCC… mRNA

Genes are located in the cell nucleus on chromosomes Karyotype

Down syndrome karyotype (trisomy 21)

DNA (deoxyribonucleic acid) mRNA Protein

Transcription movie

Translation

Translation movie

Gene expression movie

Summary A gene is a length of DNA that contains instructions for making a specific protein Genes are arranged along 23 pairs of chromosomes in the cell nucleus Genes work by specifying the amino acid sequence of a protein

Mendel’s laws

Genetic knowledge used for 1000s of years: agriculture

Patterns of disease inheritance known for 1000s of years, e.g. haemophilia

Mendel deduced the underlying principles of genetics from these patterns 1.Segregation 2.Dominance 3.Independent assortment

Mendel’s experiments

Mendel’s data

Mendel’s law of segregation A normal (somatic) cell has two variants (alleles) for a Mendelian trait. A gamete (sperm, egg, pollen, ovule) contains one allele, randomly chosen from the two somatic alleles. E.g. if you have one allele for brown eyes (B) and one for blue eyes (b), somatic cells have Bb and each gamete will carry one of B or b chosen randomly. Bb BBBBb b bb Eggs Sperm

Mendel’s law of dominance If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive. Bb BBBBb b bb Eggs Sperm

Mendel’s law of dominance If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive. Bb BBBBb b bb Eggs Sperm

Terminology… Haploid: containing one copy of each chromosome (n=23) Bb BBBBb b bb Eggs Sperm Diploid: containing two copies of each chromosome (2n=46)

Terminology… Genotype: the states of the two alleles at one or more locus associated with a trait Phenotype: the state of the observable trait GenotypePhenotype BB (homozygous)Brown eyes Bb (heterozygous)Brown eyes bb (homozygous)Blue eyes

Mendel’s law of independent assortment Knowledge of which allele has been inherited at one locus gives no information on the allele has been inherited at the other locus S/sY/y SYSySysYsYsy 25%

Mendel’s law of independent assortment SY sy Gametophytes (gamete- producing cells) SY sy Gametes Ab aB Recombinants Segregation

Mendel’s law of independent assortment SY sy Gametophytes (gamete- producing cells) SY sy Gametes Sy sY Recombinants Recombination Segregation

Simplified view of eye colour inheritance: biallelic Mendelian trait –Brown dominant: BB, Bb –Blue recessive: bb Human eye colour Bb BBBBb b bb Eggs Sperm

Human eye colour ?

? B? bb B?

Human eye colour ? Bb B?bb B?

Human eye colour ? Bb B?

Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3

Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3 P(b)=2/3x1/2=1/3P(b)=1/2

Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3 P(b)=2/3x1/2=1/3P(b)=1/2 P(bb)=1/3x1/2=1/6

Haemophilia A Males with a mutant gene are affected Females with one mutant gene are unaffected carriers Non-Mendelian inheritance: Haemophilia

Non-Mendelian inheritance: additive traits Brown eye colour is dominant

Non-Mendelian inheritance: additive traits Snapdragon red colour is additive

Non-Mendelian inheritance: polygenic traits

For example, height