Chapter 4 Molecular Cloning Methods Jay D. Hunt, Ph.D. Department of Biochemistry and Molecular Biology CSRB 4D

I. Restriction Endonucleases

Restriction endonucleases –Restriction - Bacterial encoded restriction endonucleases restrict bacteriophages to only one host strain. –Endonuclease - Restriction endonucleases cleave nucleic acids in the middle.

Subclasses of restriction endonucleases: –Type I - Recognize specific sequences and cleave DNA at a nonspecific site > than 1,000 bp away –Type II - Recognize palindromic sequences and cleave within the palindrome –Type III - Recognize specific 5-7 bp sequences and cleave bp down stream of the site. Type II restriction endonucleases are the most useful class, as they recognize specific palindromic sequences in DNA and cleave the phospodiester bonds in the ribose backbone within the palindrome

A palindrome is anything that reads the same forwards and backwards: –Mom –Dad –Tarzan raised Desi Arnaz rat. –Able was I ere I saw Elba –Doc note I dissent, a fast never prevents a fatness; I diet on cod. –Do good? I? No! Evil anon I deliver. I maim nine more hero-men in Saginaw, sanitary sword a-tuck, Carol, I–lo– rack, cut a drowsy rat in Aswan. I gas nine more hero- men in Miami. Reviled, I (Nona) live on. I do, O God!

In DNA, palindromes are defined as double stranded DNA that reads the same 5’ to 3’ The EcoRI cutting site: – 5'-GAATTC-3' – 3'-CTTAAG-5' The HindIII cutting site: – 5'-AAGCTT-3' – 3'-TTCGAA-5' Types of recognition sites: 4 bp 6 bp 8 bp 4 4 = 256 bp 4 6 = 4,096 bp 4 8 = 65,536 bp

Table 4.1

Figure 4.1

Type II restriction endonucleases cut only at specific palindromic sites; therefore, “sticky ends” result from DNA cleavage. Fragments of DNA cut with the same enzyme will hybridize to these sticky ends.

Always indicate 5’ and 3’ ends of BOTH strands. 3'CTTAAG5' 3'CTTAA5' 3'G5' 5'GGATCC3' 3'CCTAGG5' 5'G3' 5'GATCC3' 3'CCTAG5 3'G5' Eco RI Bam HI 5'GAATTC3'5'G3' 5'AATTC3' HindIII 5'AAGCTT3' 3'TTCGAA5' 5'A3' 5'AGCTT3' 3'TTCGA5' 3'A5' 5’ overhang 5'GATATC3' 3'CTATAG5' 5'GAT3' 5'ATC3' 3'CTA5' 3'TAG5' EcoRV Blunt end 3'GACGTC5'3'G5' 3'ACGTC5' 5'CTGCAG3'5'CTGCA3' 5'G3' Pst I 3’ overhang

I.Restriction Endonucleases II.Cloning

GAATTC CTTAAG GAATTC CTTAAG Cloning G CTTAA AATTC G Digest with EcoRI G CTTAA AATTC G Hybridize GAATTC CTTAAG Ligation

Text Art Page 62

Figure 4.2

Figure 4.3 Origin of replication At least one unique restriction site A selectable marker

Figure 4.4

Figure 4.5

Figure 4.6 Multicloning site  -peptide of  -galactosidase

DNA fragment up to 5 KB can insert ori p

 -peptide of  -galactosidase is encoded by lacZ NH 2 -terminal portion lacZ is disrupted by insert  -peptide is carried in genetically modified bacterial strains. COOH-terminal portion  -complementation occurs. 5-bromo-4-chloro-3-indolyl-  - D - Galactopyranoside (X-gal) is metabolized resulting in blue colonies No  -complementation occurs. White colonies

Figure 4.7b Addition of ligase would cause this to seal Without phosphate group, ligation cannot occur Phosphates are donated by the insert Ligation occurs

Figure 4.7a Note that the phosphate group is required for ligation to occur.

EcoRI Kpn I pUC18 lacZ MCS Sst I EcoRI Kpn I Sma I/Xma I BamHI Xba I Sal I/Acc I Hinc II Pst I Sph I HindIII

EcoRI Kpn I Sst I EcoRI Kpn I Sma I/Xma I BamHI Xba I Sal I/Acc I Hinc II Pst I Sph I HindIII 5'-G AATTC-3' 3'-CTTAA G-5' Digestion with EcoRI 5'-G C-3' 3'-CTTAA CATGG-5' Digestion with EcoRI & Kpn I

EcoRI Kpn I Sst I EcoRI Kpn I Sma I/Xma I BamHI Xba I Sal I/Acc I Hinc II Pst I Sph I HindIII Digest both insert and vector with EcoRI and Kpn I EcoRI Kpn I

Figure 4.8 Required for lysogenic lifecycle Required for lytic lifecycle (progeny produced) 12 to 20 KB inserts

Genomic Library Construction cos sites BamHI KB insert BamHI ~4 KB Too short, not viable

Sau3A, ~250 bp -GGATCC- -CCTAGG- BamHISau3A -GATC- -CATG- -G -CCTAG GATC- - -GGATC- -CCTAG-

Digest with BamHIPartial Digest with Sau3A Isolate pieces KB in length Combine Package into phage heads

Figure 4.9

DNA hybridization

Figure 4.10

Figure to 50 KB inserts

I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones

GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC Melt GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC Probe GCCGATTCCAGCTAGTCAAGG

CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACAAATAAGTTCAATCAGGGAACATGAC GCCGATTCCAGCTAGTCAAGG Low stringency hybridization Low stringency washing conditions High salt concentration (0.3 M NaCl) Low temperature (20 to 30°C) Low organic solvent concentrations

CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACAAATAAGTTCAATCAGGGAACATGAC GCCGATTCCAGCTAGTCAAGG Low stringency hybridization High stringency washing conditions Low salt concentration (0.03 M NaCl) High temperature (65°C) High organic solvent concentrations GCCGATTCCAGCTAGTCAAGG

I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR

Figure 4.12

Denaturation (94°C) ++ Annealing (37-65°C) Extension (72°C) TemplatePrimersdNTPs First round complete

94°C 37-65°C72°C Second round complete

30 rounds of PCR = 1,073,741,824 (1.07 X 10 9 ) copies 40 rounds of PCR = 1,099,511,628,000 (1.1 X ) copies Exponential Increase in Target DNA From 1 copy of template DNA

I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning

Figure 4.13

I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning VI.Labeling DNA with nick translation

Figure 4.14

I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning VI.Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR

Figure 4.15

I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning VI.Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR VIII.5’ RACE

Figure 4.16

I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning VI.Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR VIII.5’ RACE IX.Expression vectors

Figure 4.17

Figure 4.19a

Figure 4.19b

Figure 4.20

Figure 4.21

Figure 4.22