Introduction to Microarrays. The Central Dogma.

Slides:

Advertisements

Similar presentations

Microarray Technique, Analysis, and Applications in Dermatology Jennifer Villaseñor-Park 1 and Alex G Ortega-Loayza 2 1 Department of Dermatology, University.

Advertisements

Application of available statistical tools Development of specific, more appropriate statistical tools for use with microarrays Functional annotation of.

Statistics for Microarrays

Getting the numbers comparable

Introduction to DNA Microarrays Todd Lowe BME 88a March 11, 2003.

DNA microarray and array data analysis

Gene expression analysis summary Where are we now?

DNA Microarray Bioinformatics - #27611 Program Normalization exercise (from last week) Dimension reduction theory (PCA/Clustering) Dimension reduction.

DNA Microarray Bioinformatics - #27612 Normalization and Statistical Analysis.

Dimension reduction : PCA and Clustering Agnieszka S. Juncker Slides: Christopher Workman and Agnieszka S. Juncker Center for Biological Sequence Analysis.

Affymetrix Microarray and Illumina/ Solexa NextGen Sequencing Yuannan Xia, Ph.D Genomics Core Research Facility

Classification of Microarray Data. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical.

Statistical Analysis of Microarray Data

Dimension reduction : PCA and Clustering by Agnieszka S. Juncker

Dimension reduction : PCA and Clustering Slides by Agnieszka Juncker and Chris Workman.

DNA Arrays …DNA systematically arrayed at high density, –virtual genomes for expression studies, RNA hybridization to DNA for expression studies, –comparative.

Central Dogma 2 Transcription mRNA Information stored In Gene (DNA) Translation Protein Transcription Reverse Transcription SELF-REPAIRING ARABIDOPSIS,

Classification of Microarray Data. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical.

Microarrays: Theory and Application By Rich Jenkins MS Student of Zoo4670/5670 Year 2004.

Introduce to Microarray

Next Generation Microarray Technology: Overview of Febit’s Geniom One ® H. Bjørn Nielsen Center for Biological Sequence analysis Technical University of.

Gene Expression BMI 731 Winter 2005 Catalin Barbacioru Department of Biomedical Informatics Ohio State University.

Introduction to DNA microarrays DTU - January Hanne Jarmer.

Scanning and image analysis Scanning -Dyes -Confocal scanner -CCD scanner Image File Formats Image analysis -Locating the spots -Segmentation -Evaluating.

Gene Expression Data Analyses (1) Trupti Joshi Computer Science Department 317 Engineering Building North (O)

Analysis of GO annotation at cluster level by H. Bjørn Nielsen Slides from Agnieszka S. Juncker.

Genomics I: The Transcriptome RNA Expression Analysis Determining genomewide RNA expression levels.

Microarrays: Basic Principle AGCCTAGCCT ACCGAACCGA GCGGAGCGGA CCGGACCGGA TCGGATCGGA Probe Targets Highly parallel molecular search and sort process based.

and analysis of gene transcription

Microarray Preprocessing

Lecture 189Functional Genomics Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

Microarrays, RNAseq And Functional Genomics CPSC265 Matt Hudson.

Affymetrix vs. glass slide based arrays

Experimental Design and Setup. Experimental Design What is the question? Which experiments will give the answer? How many replicates do we need?

Lecture 22 Introduction to Microarray

Data Type 1: Microarrays

Gene Expression Data Qifang Xu. Outline cDNA Microarray Technology cDNA Microarray Technology Data Representation Data Representation Statistical Analysis.

Introduction to DNA microarrays DTU - May Hanne Jarmer.

Microarray - Leukemia vs. normal GeneChip System.

Scenario 6 Distinguishing different types of leukemia to target treatment.

ARK-Genomics: Centre for Comparative and Functional Genomics in Farm Animals Richard Talbot Roslin Institute and R(D)SVS University of Edinburgh Microarrays.

Introduction to DNA microarray technologies Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor short course Summer 2002.

What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Genomics I: The Transcriptome

GeneChip® Probe Arrays

Topic intro slides More complete coverage of components involved in gene expression More information on expression technologies -what would the ideal chip.

Analysis of GO annotation at cluster level by Agnieszka S. Juncker.

MICROARRAY TECHNOLOGY

1 Genomics The field of biology based on studying the entire DNA sequence of an organism - its “genome”. Genomics tools don’t replace classical genetics.

Introduction to Microarrays.

DTU - January Hanne Jarmer

DNA Microarrays M. Ahmad Chaudhry, Ph. D. Director Microarray Facility University of Vermont.

Idea: measure the amount of mRNA to see which genes are being expressed in (used by) the cell. Measuring protein might be more direct, but is currently.

Statistical Analysis of Microarray Data By H. Bjørn Nielsen.

Microarray (Gene Expression) DNA microarrays is a technology that can be used to measure changes in expression levels or to detect SNiPs Microarrays differ.

Microarray hybridization Usually comparative – Ratio between two samples Examples – Tumor vs. normal tissue – Drug treatment vs. no treatment – Embryo.

Overview of Microarray. 2/71 Gene Expression Gene expression Production of mRNA is very much a reflection of the activity level of gene In the past, looking.

ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.

Lecture 23 – Functional Genomics I Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

Transcriptome What is it - genome wide transcript abundance How do you obtain it - Arrays + MPSS What do you do with it when you have it - ?

Introduction to Oligonucleotide Microarray Technology

Microarray: An Introduction

MICROARRAY. Microarray  A multiplex lab-on-a-chip  A 2D array on a solid substrate (Usually a glass slide or silicon thin-film cell) that assays large.

The Central Dogma. Life - a recipe for making proteins DNA protein RNA Translation Transcription.

Using Web-Based Tools for Microarray Analysis

Microarray Technology and Applications

Introduction to Microarrays.

Getting the numbers comparable

Data Type 1: Microarrays

Presentation transcript:

Introduction to Microarrays

The Central Dogma

Hybridization A A A T T G G C C T A T G A T G C C A A A T T G G C C T A T G A T G C C

Introduction to Microarrays

Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

Why not Northern? RNA

How? gene specific DNA probes labeled target gene mRNA

Microarrays - The Technologies Stanford Microarrays Affymetrix

Stanford Microarrays Glass slides Deposition of probes Ready-to-use array Hybridization

Making Microarrays 1. Produce probes 2. Print by the use of a robot oligos cDNA library PCR products

Spotting - Mechanical deposition of probes

16-pin microarrayer

Sample preparation 1. Design experiment Question? Replicates? Test? 2. Perform experiment 4. Label RNA Amplification? Direct or indirect? Label? wild type mutant 3. Precipitate RNA Eukaryote/prokaryote? Cell wall?

mRNA cDNA Cy3-cDNACy5-cDNA SAMPLE CONTROL Stanford microarrays DESIGN and ORDER PROBES

Affymetrix GeneChip ® oligonucleotide array 11 to 20 oligonucleotide probes for each gene On-chip synthesis of 25 mers ~ genes per chip good quality data – low variance

Example Catalog Arrays Human Mouse Rat Arabidopsis C. elegans Canine Drosophila E. coli P. aeruginosa Plasmodium/Anopheles Vitis vinifera (Grape) Xenopus laevis Yeast Zebrafish NimbleExpress™ Array Program

Fluidic Station and Scanner

The Affymetrix Genechip ®

TTT T T T T T T T A A A A A A A AAA Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #1 Mask #2

Photolithography - Micromirrors NimbleExpress™ Array Program

The Affymetrix GeneChip ® A gene is represented like this: - Perfect Match (PM) - MisMatch (MM) PM MM PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

The Technologies - Costs - Flexibility - Data Quality Affymetrix Spotter

Facility setup: Stanford Microarrays < 100,000 USD Affymetrix< 250,000 USD The Technologies – Cost Cost pr. array Stanford Microarrays USD Affymetrix USD NimbleExpress™ Array Program - a bit more expensive

The Technologies - Flexibility Stanford microarrays: Are flexible, but new probes must be ordered each time Affymetrix arrays: Are not flexible, unless you order the NimbleExpress™ chip

The Technologies - Data Quality Reproducibility of data: (Pearson’s correlation coefficient) Stanford microarrays: Affymetrix:  0.95

The Technologies - Choice of Stanford microarrays: If you work with unsequenced species Low budget Affymetrix: Only sequenced species High data quality

Analysis of Data Normalization: Linear or non-linear Statistical test: student’s t-test ANalysis Of VAriance (ANOVA) Analysis: Principle Component Analysis (PCA) Clustering and visualization

Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical Analysis Fit to Model (time series) Expression Index Calculation Advanced Data Analysis ClusteringPCAClassification Promoter AnalysisRegulatory Network Comparable Gene Expression Data Normalization Image analysis The DNA Array Analysis Pipeline