Lacie Smith April 22, 2005 Department of Chemistry and Biochemistry Can we fix it! Yes we can! Synthesis of Novel Quorum Sensing molecules.

Slides:

Advertisements

Similar presentations

Critique of “A universal RNAi-based logic evaluator that operates in mammalian cells”

Advertisements

Inhibition of Staphylococcus aureus biofilm formation using AIP Jordan Shivers Kevin Kim Professor Howard Stone.

Cancer Cells!!! An Uncontrollable Growth!!

Programmed population control by cell-cell communication and regulated killing Lingchong You, Robert Sidney Cox III, Ron Weiss & Frances H. Arnold Programmed.

Course Code Course Title Credits BMS 500 Responsible Conduct of Research 1 BMS 510F Biochemistry and Cell Biology 10 BMS 512 Critical Thinking 1 BMS 523A.

Chapter 18 Regulation of Gene Expression.

Bacterial Quorum Sensing Many species of bacteria use quorum sensing to coordinate their gene expression according to the local density of their population.

Advanced Microbial Physiology Lecture 4 Quorum Sensing.

1 AP BIOLOGY. 2 3 Testing Information Date: Mon. May 11,2015 Content: Four Big Ideas Evolution Energy and Living Systems Processes of Living Systems.

Warm-Up Why do you communicate? How do you communicate?

Quorum sensing, Two component signaling and Bacterial Photography.

Announcements Exam 3: All material covered since exam 2 including:

Biotechnology: Bacterial Transformation Lab

Frontiers of Genetics Chapter 13.

F INDINGS National Institutes of Health National Institute of General Medical Sciences Bugging the Bugs Microbial Geneticist Bonnie Bassler: Investigating.

ANTI-MICROBIALS – MEDICINAL CHEMISTRY Timothy Curd - Sunderland University - Supervised by Mark Ashton and Dr Yu Gong. Special acknowledgement to the Nuffield.

How do plants fight bacteria ?. Bacterium Plant cell When bacteria get in contact with plant cells…

Warm-Up  Why do you communicate?  How do you communicate?  How do you think cells communicate?  Do you think bacteria can communicate? Explain.

Gene Regulation Gene Regulation in Prokaryotes – the Jacob-Monad Model Gene Regulation in Prokaryotes – the Jacob-Monad Model certain genes are transcribed.

CHAPTER 11 CELL COMMUNICATION 1. WHAT YOU SHOULD KNOW: The 3 stages of cell communication: reception, transduction, and response. How G-protein-coupled.

Section 2 CHAPTER 10. PROTEIN SYNTHESIS IN PROKARYOTES Both prokaryotic and eukaryotic cells are able to regulate which genes are expressed and which.

Taattcgcggccgcttctagagattgtgagcggataacaattgacattgtgagcggataacaagatactgagcactactagagaaagaggagaaatactagatgactataatgataaaaaaat cggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactc.

By Sachi Lagwankar Quorum Sensing. process of bacterial cells “talking” to each other in order to be informed of the population density in its vicinity.

Microbial Genetics - DNA Transfer l Review of Information Transfer in Cell l Recombination l Transfer of DNA &Genetic Recombination in Bacteria –Conjugation.

Biofilms Dense aggregates of surface-adherant microorganisms embedded in an exopolysaccharide matrix. 65% of human bacterial infections involve biofilms!

Do Cyanobacteria Communicate With Each Other? Bacterial Communication Quorum Sensing Important to perform group functions Secretion of toxins to kill.

CLO: I can use thinking strategies to monitor meaning, build schema and determine importance about enzymes from a text. Do Now: What is a personal goal.

Programmed population control by cell-cell communication and regulated killing Lingchong You, Robert Sidney Cox III, Ron Weiss & Frances H. Arnold Programmed.

Cell Communication Warm-Up 1. Why do you communicate? 2. How do you communicate? 3. How do you think cells communicate? 4. Do you think bacteria can communicate?

The Issue source: Australian Government Dept. of Agriculture

AP Biology Cell Communication CHAPTER 11. Warm-Up 1. Why do you communicate? 2. How do you communicate? 3. How do you think cells communicate? 4. Do you.

Protein Synthesis Control Mechanisms. Control Mechansisms the human genome contains about genes that code for proteins housekeeping genes.

35.2 Defenses Against Infection

Non-Aqueous Phase Liquids. (Chlorinated compounds or petroleum hydrocarbon)

BIO409/509 Cell and Molecular Biology. SECOND Methods paper assignment due Wed., 4/20 (you don’t do this assignment if you are in the 4H STEM Ambassador.

Genetics of Bacteria Chapter 8 Part 2.

Cancer Cells. Cell Review What kind of cell is this bacterial cell? What are the types of cells plants have?

Chapter 8, part B Microbial Genetics.

Chapter 8, part B Microbial Genetics.

Computational Modeling of DNA Binding Molecules

Quorum-sensing.

Warm-Up Why do you communicate? How do you communicate?

Warm-Up Why do you communicate? How do you communicate?

Curious Question What is a second messenger? What are some examples of these molecules? What are the possible responses to signal transduction in a cell?

Warm-Up Why do you communicate? How do you communicate?

Tissues, Organs, and Organ Systems

quorum sensing & biofilms

Warm-Up Why do you communicate? How do you communicate?

Warm-Up Why do you communicate? How do you communicate?

Option B.3 Environmental Biotechnology

Lecture 7: Biological Network Crosstalk Y. Z

Bugging the Bugs Microbial Geneticist Bonnie Bassler:

Essential knowledge 3.D.2:

Programmable cells: Interfacing natural and engineered gene networks

POGIL: Cell Communication

Gene Regulation certain genes are transcribed all the time – constitutive genes synthesis of some proteins is regulated and are produced only when needed.

Virulence factors of Bacteria that cause disease Submitted By : Nesren alkakhrass Supervised By: Dr. Abedelraouf A. Elmanama ( Ph.sc Microbiology.

Cell Communication CHAPTER 11.

Warm-Up Why do you communicate? How do you communicate?

Unit 5, Part 1 Notes – Basics of Cell Signaling

Warm-Up Why do you communicate? How do you communicate?

Warm-Up Why do you communicate? How do you communicate?

Warm-Up Why do you communicate? How do you communicate?

Warm-Up Why do you communicate? How do you communicate?

Volume 109, Issue 4, Pages (May 2002)

Chapter 8, part B Microbial Genetics.

INTRODUCTION Vibrio fischeri Hawaiian Bobtail Squid.

Presentation transcript:

Lacie Smith April 22, 2005 Department of Chemistry and Biochemistry Can we fix it! Yes we can! Synthesis of Novel Quorum Sensing molecules

Bacteria What are bacteria? How do bacteria communicate with one another? Quorum sensing

Research Questions By making new signaling molecules which resemble the bacterial signaling molecule: Will we be able to interfere with the bacterial communication? Will a damaging agent attach to the signaling molecules so that the bacteria cells will be killed?

Goal To make several similar compounds with a variation in “R” group

Methods Overall Scheme:

Why is this project important?  Would benefit the medical, sewage, and marine environment  Would offer a new approach in fighting infections

References Bassler Bonnie: How bacteria talk to each other: regulation of gene expression by quorum sensing, Microbiology 1999, 2: Brelles-Marino G; Bedmar E.; Journal of Biotechnology , March J, Bentley W: Quorum sensing and bacterial cross-talk in biotechnology. Biotechnology 2004,15: