Today House Keeping –(field trip, ppts) Update on research progress –(what have we done) Clean up PCR reactions Direct sequencing

FIELDTRIP to Sevilleta LTER, Sample collection: Sunday 13 September Cook, Kelsey Greaves, Conrad T. Lopez Leslie Janet McBride, Timothy R. Mendoza, Janette Y. Parra, Amalia S. Perales, Gabriela

15 minute powerpoint topics(G+) datetopicname 21-SepDiscovery of DNA structureJanette Mendoza 25-SepRestriction enzymesGabriela Perales 28-SepSouthern blottingCarlos GarciaG 2-OctCloningTimothy McBrideG 6-OctThe first sequenced geneConrad Greaves 13-Oct(q)PCR, specificity and sensitivity Krystal Charly 16-OctESTsIan Keller 20-OctBLAST and database searchesRyan HeimrothG 23-OctMicroarraysBianca Myers 26-OctForensicsJennifer Gutierrez 30-Oct Genome sequencing, the $1000 genome Ayesha ArefinG 2-NovNext generation sequencingLeslie Janet LopezG 6-NovBioinformaticsAmalia Parra 9-NovEpigeneticsClyde Moya 13-Novnon-coding RNAHelen Nordquist 16-NovC-value paradoxKelsey CookG 20-NovPhylogenetic genomicsJennifer Cooksey 23-Nov Genes associated with Type 1 diabetes Katie Kesler

Update experiments/results What techniques? What experiments? What results? What is in our most recent reaction tubes?

PARASITES AND SNAIL BIOLOGY “identity, possibilities” phylogenetics “intentions” transcriptomics PCR rDNA/mito Bioanalyzer DNA-free, direct sequencing gel electrophoresis nanodrop spec Sequence ID (BLAST) editing Phylogenetics electrophoresis RT-PCR gel CTAB Trizol TA cloning, B/W screening M13 sequencing Primer design, walking Qiagen plasmid extraction Restriction digests DNA RNA GenBank submission

PCR results? Group Ssnail parasite 16S COI18S 28S Expect

+

Work schedule today Follow protocol "spin columns" Each group will do a forward and a reverse direct sequencing reaction of target amplicons Lecture

Proceed according to handout GroupSAMPLE TARGET/PRIMER 16SCOI 11FR 22FR 33F,R 55FR 64FR 75RF 84RF 91RF 102RF

Separation of nucleic acids at neutral pH on QIAGEN Anion-Exchange ResinElution points of different nucleic acids from QIAGEN Resin as a function of pH and NaCl concentration

SEQUENCING: POLYMERASE ACTION ONE PRIMER DEOXYNUCLEOTIDES VERSUS DIDEOXYNUCLEOTIDES LABEL ALL SIZES WITH UNIQUE LABEL TO IDENTIFY THE TERMINAL NUCLEOTIDE

Sequencing PARAMETERS PRIMER SEQUENCES THERMAL CYCLING BigDye step profile 1’ 96C (hot top at 106C) 10” 96C 15x 30” 50C or Tm 1’15" 60C 10” 96C 5x 30” 50C or Tm 1’30" 60C 10” 96C 5x 30” 50C or Tm 2’00" 60C ∞ 4C PCR CHEMISTRY BigDye v.3.1 (ABI) contents? [primer stock] 1.6  molar template 2  l SPECIFIC AMPLICON Water 16SAr_F: PU178 5' GCACCCGCTGAAYTT 3' 16SBr_R: PL1642 5' CCAGCGCCATCCATTTTCA 3‘ LCO1490 F: 5'GGTCAACAAATCATAAAGATATTGG -3’ HC02198 R: 5'TAAACTTCAGGGTGACCAAAAAATCA-3’

Sequencing cleanup Cleanup of sequencing reaction extension products Why Removal of unincorporated fluorescent ddNTPs (background) Removal of reaction ingredients aids downstream manipulation How Precipitation (remember how) Small nucleic acids (ddNTPs) do not precipitate as readily as extension products, removed with washing