Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?

Slides:

Advertisements

Similar presentations

Lysosome Nucleus ER Plasma Membrane Mitochondria Golgi.

Advertisements

Chapter 13 Intracellular Vesicular Traffic 張學偉助理教授.

Lesson 3: Translation.

Intracellular Transport1 Chapter 15 You should review functions of different organelles We already discussed evolution; review Focus will be on: 1) mechanisms.

Chapter 12 Intracellular Compartments and Protein Sorting.

Biochemical aspects. Learning objectives At the end of lecture student should be able to Describe the structure of cell membrane Explain molecular basis.

Bulk Transport/Vessicular Traffic Bulk transport refers to the transport of solutes enclosed in vesicles. Many of these solutes are too large to diffuse.

Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.

The Cell Membrane. Overview Cell membrane separates living cell from nonliving surroundings – thin barrier = 8nm thick Controls traffic in & out of the.

Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.

Lecture 18: Intracellular transport Flint et al., Chapter 12.

Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor Depertment of Genetics, Cell- and Immunoibiology Semmelwesi University Semmelwesi University2008.

Transport, con't.. The Na/K ATPase Consequences of Na/K ATPase Two ion gradients –Used as energy source –Electrical signaling Charge difference across.

Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.

Molecular mechanism of vesicular transport Vesicular pathway--Budding and fusion 1.Budding— how are vesicles formed? How can cargo proteins be selectively.

Most proteins in the ER are glycosylated Proteins in cytosol are rarely glycosylated original precursor oligosaccharide added to most proteins in the ER.

Lecture 16 Vesicle transport and targeting in the secretory pathway

Cytoplasmic Membrane Systems II Lecture 12. How Do Proteins Get Imported Into Membrane Enclosed Organelles? Import Requires Input of Energy to Occur!

Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor Depertment of Genetics, Cell- and Immunoibiology Semmelwesi University Semmelwesi University.

Lecture 6 - Intracellular compartments and transport I.

Lecture 3 Vesicular Trafficking -Cops and Clathrins -Arfs, Rabs, Sars -Snares.

Protein trafficking between membranes By Graham Warren & Ira Mellman

Extra credit for Midterm 2

Chapter 25 Protein trafficking Introduction 25.2 Oligosaccharides are added to proteins in the ER and Golgi 25.3 The Golgi stacks are polarized.

Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?

Previously: Getting things made Now: getting them where they need to go: Protein Targeting Translation: Converting nucleotide sequence to amino acid chain.

Summary 1.Rough ER and smooth ER; 2.Signal hypothesis, translocation into ER; 3.Single-span and multi-span membrane proteins; 4.Glycosylation; 5.Protein.

The Secretory Pathway Becky Dutch Molecular and Cellular Biochemistry 1. ER - translation 2. ER- protein modifications 3. Discussion Section 4. Golgi apparatus.

INTD5000, Lectures C7 & C8 Professor Eileen M. Lafer Tel#: Office: Room 415B THE SECRETORY AND ENDOCYTIC PATHWAYS.

Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.

Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?

Endocytosis & Exocytosis By : Matt Sargeant. What is Endocytosis and Exocytosis? Endocytosis is a process by which cells absorb molecules (such as proteins)

MOLECULAR CELL BIOLOGY SIXTH EDITION MOLECULAR CELL BIOLOGY SIXTH EDITION Copyright 2008 © W. H. Freeman and Company CHAPTER 14 Vesicular Traffic, Secretion,

Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.

MOLECULAR CELL BIOLOGY SIXTH EDITION MOLECULAR CELL BIOLOGY SIXTH EDITION Copyright 2008 © W. H. Freeman and Company CHAPTER 13 Moving Proteins into Membranes.

Now on Bio308 Translation: Converting the blueprint into a working model 36” 72’ Grade P red oak, inlay mahaog.

ER and Golgi: Working Together! Mr. Nichols PHHS.

BIOAVAILABILITY Time course of drug in the body: route of drug administration Oral vs IV injection Reasons for differences: completeness and rate of absorption.

BIO201A Cell Biology Lecture 29 Wednesday 04/04/07.

Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?

Dynamin - Monique Krüger - e4b07fbe88868c13%2F %2FBDLPxtal_map_filament.png&imgrefurl=http%3A%2F%2Fwww.thelowlab.org%2Fr

1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.

The Synaptic transmission M.Bayat PhD

Chapter 12 Intracellular Compartments and Protein Sorting.

Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure

Getting things where they need to go: Protein Targeting Translation: Converting nucleotide sequence to amino acid chain Role of tRNA, base pairing and.

Neurotransmitter Release. High voltage Low voltage.

Vesicular Transport Pages The general flow of membrane enclosed material within cells.

Vesicular Trafficking Movement From the ER Through the Golgi.

Questions How does RNA polymerase work and what does it make? How does it know where to start and stop? How does a ribosome work and what does it make?

Lecture 12: The secretory pathway

The ER and Golgi Modify & Sort Proteins

Vesicular Trafficking

Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor

Modified tRNAs allowed isolation (cross-linking approach) and analysis (fluorescence quenching ) of translocation channel.

INTD5000, REVIEW, Lectures C7-C8

Intracellular Transport Pathways

The Mechanisms of Vesicle Budding and Fusion

The Road Taken Cell Volume 100, Issue 1, Pages (January 2000)

structure & function of eukaryotic organelle

By: Waleedullah Jan BSc Human Biology

Molecular Mechanisms in Synaptic Vesicle Endocytosis and Recycling

Penetration through cellular membranes Intracellular transport

Endocytic trafficking of CFTR in health and disease

Tracing the Retrograde Route in Protein Trafficking

Springs and zippers: coiled coils in SNARE-mediated membrane fusion

Chapter 13 Intracellular Vesicular Traffic.

Sonja M. Wojcik, Nils Brose Neuron

Cell Transport Review.

Intracellular Compartments and Vesicular Trafficking

Presentation transcript:

Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered? Proteins made in cytosol Sorting places proteins in membrane and in lumen of organelles PM (and other) proteins use Sec or SRP mediated translocation to become inserted into the ER (and only the ER) After insertion non-ER proteins are sorted and delivered lumenal vs membrane proteins let’s building a bud

Budding Fig CBI 13.1 Clathrin

Coat Components Clathrin COPI COPII Identity determined by what the vesicle contains and it’s coat.

Budding II ER vesicle budding Drin, G, and B. Antonny (2005) News and Views: Helices sculpt membrane. Nature vol: 437 Amino Acid Key Highly hydrophobic + charged - charged Other Hydroxylated Sar1p N-terminal helix Sar1p-GTP form exposes helix that anchors protein to ER surface by ‘floating’ with hydrophobic a.a. interacting with membrane core

Budding III Drin, G, and B. Antonny (2005) News and Views: Helices sculpt membrane. Nature vol: 437 ER vesicle budding Floating many Sar1p in top leaflet makes it ‘bigger’ than the bottom one. Results --> bulge that can more easily interact with coat proteins.

Fission ER vesicle budding….fission Ring of parallel helices at neck might aid fission. New data for ER; had seen a protein (epsin) help deform PM for clathrin coated vesicles. May suggest that using a helix to deform membrane is common mechanism for budding/fission

Targeting/Docking: What happens after budding? How do vesicles dock with specific target membrane?

The SNARE hypothesis Fig V-SNARE T-SNARE Role of p115 Role of Rab proteins retrograde

Synaptic vesicle fusion VAMP Syntaxin SNAP 25 Synaptotagmin Rab3a

Moving in the other direction: endocytosis Types: Phagocytosis– specialized cells Pinocytosis– all cells Connection– perhaps the # of our receptor’s on PM is controlled by endocytosis Pinocytosis ‘problem’ rate of pinocytosis internalizes 100% of PM per hour ? (How can this be?)