Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?

Slides:



Advertisements
Similar presentations
The endoplasmic reticulum and the Golgi apparatus permit protein construction and transport in a cell. 11/20 How are cells are divided into organelles.
Advertisements

Lysosome Nucleus ER Plasma Membrane Mitochondria Golgi.
Chapter 13 Intracellular Vesicular Traffic 張學偉 助理教授.
Lesson 3: Translation.
Intracellular Transport1 Chapter 15 You should review functions of different organelles We already discussed evolution; review Focus will be on: 1) mechanisms.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Biochemical aspects. Learning objectives At the end of lecture student should be able to Describe the structure of cell membrane Explain molecular basis.
Bulk Transport/Vessicular Traffic Bulk transport refers to the transport of solutes enclosed in vesicles. Many of these solutes are too large to diffuse.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
Intracellular Compartments ER, Golgi, Endsomes, Lysosomes and Peroxisomes.
Last Class: 1. transportation at the plasma membrane A. carrier protein, B. channel protein 2. intracellular compartments A. nucleus, B. Endoplasmic Reticulum.
Lecture 18: Intracellular transport Flint et al., Chapter 12.
Transport, con't.. The Na/K ATPase Consequences of Na/K ATPase Two ion gradients –Used as energy source –Electrical signaling Charge difference across.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Molecular mechanism of vesicular transport Vesicular pathway--Budding and fusion 1.Budding— how are vesicles formed? How can cargo proteins be selectively.
CHAPTER 8 Part 2 Cytoplasmic Membrane Systems: Structure, Function, and Membrane Trafficking Copyright © 2008 by John Wiley & Sons, Inc.
Vesicular Traffic II. Endocytic and secretory pathways red = secretory green = endocytic blue = recycling.
Most proteins in the ER are glycosylated Proteins in cytosol are rarely glycosylated original precursor oligosaccharide added to most proteins in the ER.
Lecture 16 Vesicle transport and targeting in the secretory pathway
Cytoplasmic Membrane Systems II Lecture 12. How Do Proteins Get Imported Into Membrane Enclosed Organelles? Import Requires Input of Energy to Occur!
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor Depertment of Genetics, Cell- and Immunoibiology Semmelwesi University Semmelwesi University.
Topic 41 4.Structure/Function of the Organelles - Synthesis.
Lecture 6 - Intracellular compartments and transport I.
Lecture 7 - Intracellular compartments and transport II
Lecture 3 Vesicular Trafficking -Cops and Clathrins -Arfs, Rabs, Sars -Snares.
Protein trafficking between membranes By Graham Warren & Ira Mellman
Extra credit for Midterm 2
Chapter 25 Protein trafficking Introduction 25.2 Oligosaccharides are added to proteins in the ER and Golgi 25.3 The Golgi stacks are polarized.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
Summary 1.Rough ER and smooth ER; 2.Signal hypothesis, translocation into ER; 3.Single-span and multi-span membrane proteins; 4.Glycosylation; 5.Protein.
The Secretory Pathway Becky Dutch Molecular and Cellular Biochemistry 1. ER - translation 2. ER- protein modifications 3. Discussion Section 4. Golgi apparatus.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
Endocytosis & Exocytosis By : Matt Sargeant. What is Endocytosis and Exocytosis? Endocytosis is a process by which cells absorb molecules (such as proteins)
BIOL 200 (Section 921) Lecture # 9, 10 June 29/30, 2006 Readings ECB (2nd ed.) Chapter 15 (Whole chapter): Introduction, pp ; Protein Sorting pp.
MOLECULAR CELL BIOLOGY SIXTH EDITION MOLECULAR CELL BIOLOGY SIXTH EDITION Copyright 2008 © W. H. Freeman and Company CHAPTER 14 Vesicular Traffic, Secretion,
Molecular and Cellular Biochemistry 2. ER- protein modifications
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
ER and Golgi: Working Together! Mr. Nichols PHHS.
BIO201A Cell Biology Lecture 29 Wednesday 04/04/07.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
Pg. 367.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure
TRANSPORT ACROSS CELL MEMBRANES Endocytosis and Exocytosis.
Getting things where they need to go: Protein Targeting Translation: Converting nucleotide sequence to amino acid chain Role of tRNA, base pairing and.
Neurotransmitter Release. High voltage Low voltage.
Vesicular Transport Pages The general flow of membrane enclosed material within cells.
Vesicular Trafficking Movement From the ER Through the Golgi.
MB207 Molecular Cell Biology Intracellular Vesicular Traffic Outline: Principles of vesicular traffic Transport from ER through Golgi Apparatus Transport.
Lecture 12: The secretory pathway
The ER and Golgi Modify & Sort Proteins
Subcellular compartments that constitute the cellular endomembrane system. The major organelles of the endomembrane system are: the endoplasmic reticulum.
Active Transport Processes
Protein Sorting & Transport
Vesicular Trafficking
Subcellular compartments that constitute the cellular endomembrane system. The major organelles of the endomembrane system are: the endoplasmic reticulum.
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor
Intracellular Trafficking
Intracellular Compartments and Transport 2
INTD5000, REVIEW, Lectures C7-C8
Intracellular Transport Pathways
The Mechanisms of Vesicle Budding and Fusion
The Road Taken Cell Volume 100, Issue 1, Pages (January 2000)
structure & function of eukaryotic organelle
By: Waleedullah Jan BSc Human Biology
Translation B Sc III Mr. Maruti Hake Dept.of Botany
Chapter 13 Intracellular Vesicular Traffic.
Intracellular Compartments and Vesicular Trafficking
Presentation transcript:

Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered? Sorting places proteins in membrane and in lumen of organelles PM (and other) proteins use Sec or SRP mediated translocation to become inserted into the ER (and only the ER) After insertion non-ER proteins are sorted and delivered sorting lumenal vs membrane proteins –how?

ER ER proteins Where can a protein end up in the ER?How does it get there? Lumenal proteins Single transmembrane span proteins Multipass transmembrane proteins What category do our neurotransmitter and neurotransmitter receptor fall in?

How do you get soluble lumenal proteins vs ‘Type III’ What’s different? How does it happen?

Getting out of the ER ER Golgi enzyme involved in glycosylation Lysosomal acid hydrolase Neurotransmitter receptor Now what?

Vesicular traffic Secretory pathway: also method for delivering new PM proteins ER to Golgi to trans-Golgi network  then constitutive or regulated exocytosis

Constitutive and Regulated Exocytosis Constitutive= constant, sometimes called ‘bulk flow’ Regulated= needs additional signal to initiate fusion of vesicle with PM Constitutive does not mean ‘un-regulated’

Stages of vesicle traffic 3 Stages: Budding, targeting/docking and fusion Donor Target

Consequences of unregulated vesicular traffic Mixing of organelle contents (  won’t function correctly) Mislocalization of proteins (  won’t function correctly) Inappropriate levels of secretion (too hi or too lo) A Dead Cell

Vesicular traffic control How does a vesicle ‘know’ what components it should contain? How does it ‘know’ which membrane it should go to? How does it fuse when it gets there? Our neurotransmitter receptor need to go ‘through’ 5 cellular compartments before it gets to the post synaptic membrane

Content selection What goes inside which vesicle? Lumenal protein: Transmembrane proteins: Combination of cytosolic and lumenal proteins determine specific vesicle content

Budding Fig

Coat Components Clathrin COPI COPII Identity determined by what the vesicle contains and it’s coat.

Budding II ER vesicle budding Drin, G, and B. Antonny (2005) News and Views: Helices sculpt membrane. Nature vol: 437 Amino Acid Key Highly hydrophobic + charged - charged Other Hydroxylated Sar1p N-terminal helix Sar1p-GTP form exposes helix that anchors protein to ER surface by ‘floating’ with hydrophobic a.a. interacting with membrane core

Budding III Drin, G, and B. Antonny (2005) News and Views: Helices sculpt membrane. Nature vol: 437 ER vesicle budding Floating many Sar1p in top leaflet makes it ‘bigger’ than the bottom one. Results --> bulge that can more easily interact with coat proteins.

Fission ER vesicle budding….fission Ring of parallel helices at neck might aid fission. New data for ER; had seen a protein (epsin) help deform PM for clathrin coated vesicles. May suggest that using a helix to deform membrane is common mechanism for budding/fission

Targeting/Docking: What happens after budding? How do vesicles dock with specific target membrane?

The SNARE hypothesis Fig V-SNARE T-SNARE Role of p115 Role of Rab proteins retrograde

Synaptic vesicle fusion VAMP Syntaxin SNAP 25 Synaptotagmin Rab3a

Next: Moving in the other direction: endocytosis Types: Phagocytosis– specialized cells Pinocytosis– all cells Connection– perhaps the # of our receptor’s on PM is controlled by endocytosis Pinocytosis ‘problem’ rate of pinocytosis internalizes 100% of PM per hour ? (How can this be?)