Golgi complex BIOLOGY, Faculty of Medicine and Dentistry 2015. 10. 05. László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology.

Slides:



Advertisements
Similar presentations
Protein sorting and the Golgi apparatus
Advertisements

Chapter 13 Intracellular Vesicular Traffic 張學偉 助理教授.
Golgi complex László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology Semmelweis University 2008.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
Cell Structure and Function Chapter 3 Basic Characteristics of Cells Smallest living subdivision of the human body Diverse in structure and function.
Intracellular Compartments ER, Golgi, Endsomes, Lysosomes and Peroxisomes.
Intracellular Compartments
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Biology 107 Cell II September 23, Cell II Student Objectives:As a result of this lecture and the assigned reading, you should understand the following:
Lecture 11 Vesicular Trafficking: Lysosomes;
Glycoconjugates Carbohydrates covalently linked to a protein or lipid act as informational carrier in: cell-cell recognition, cell-cell adhesion, cell.
Vesicular Traffic II. Endocytic and secretory pathways red = secretory green = endocytic blue = recycling.
Vesicular Transport III. N-linked glycosylation because sugar is added to N of asparagine. original precursor oligosaccharide added to most proteins in.
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor Depertment of Genetics, Cell- and Immunoibiology Semmelwesi University Semmelwesi University.
Chemical reactions in cells need to be isolated. Enzymes work in complexes, spatial distribution in cytosol, nucleus Confinement of reactions in organelle.
Lecture 7 - Intracellular compartments and transport II
Protein Secretion Sarah Thomas. Secretory Pathway n Ribosomes that are synthesizing proteins and bear an ER signal sequence bind to rough ER. n Once transcription.
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
Tour of the Cell
Extra credit for Midterm 2
The Golgi Body. Discovery Named after Camillo Golgi He was an Italian biologist who discovered the organelle with a light microscope in 1897.
Golgi Apparatus Lecture 10, Cell Biology. Discovery of Golgi body  The Golgi apparatus is noticeable with both light and electron microscope. It is also.
Functions Site for concentrating and packing the materials in other parts of the cell e.g. proteins newly synthesized in the rough ER are transported.
Chapter 25 Protein trafficking Introduction 25.2 Oligosaccharides are added to proteins in the ER and Golgi 25.3 The Golgi stacks are polarized.
Read Chapter 4 (all of it) you have a test soon!.
Endoplasmic Reticulum, Golgi Complex, Lysosome, Peroxisome
Eukaryote Organelles BIO 224 Intro to Molecular and Cell Biology.
Cell Architecture. CELL THEORY Mathias Schleiden and Theodore Schwann Prokaryotic cell Eukaryotic cell – plant cell and animal cell Figure 9-1.
CHAPTER 6 SYSTEMS BIOLOGY OF CELL ORGANIZATION
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.
The Golgi Apparatus.
Molecular and Cellular Biochemistry 2. ER- protein modifications
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
Golgi complex BIOLOGY, Faculty of Medicine and Dentistry László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology.
Cytosol. The cytosol or intracellular fluid (or cytoplasmic matrix) is the liquid found inside cells. The cytosol is a complex mixture of substances dissolved.
Golgi Apparatus By: Kousha Zamanipour 306. What is The Golgi Apparatus?  The golgi apparatus can also be referred to as “the post office” of the cell.
8. Protein Synthesis and Protein Processing a). Ribosome structure b). Protein synthesis i). Initiation of protein synthesis ii). Peptide bond formation;
Cell and Molecular Biology Behrouz Mahmoudi Cell organelles-2 1.
Ch. 3 Cell Organization. Cells and Tissues Carry out all chemical activities needed to sustain life Cells are the building blocks of all living things.
Endocytosis - Exocytosis
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Conference on RER, Golgi, and secretion
 Golgi apparatus or golgi complex or simple Golgi is an organelle found in most of the eukaryotic cells.  It was one of the first organelle to be.
GOLGI APPARATUs.
 The endoplasmic reticulum (ER) in the cells of eukaryotic organisms is an interconnected network of flattened, membrane-enclosed sacs or tubes known.
 The Golgi apparatus (Golgi complex, Golgi body, Golgi) is an organelle found in eukaryotic cells. The Golgi apparatus was first discovered by Italian.
Vesicular Trafficking Movement From the ER Through the Golgi.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Lecture 12: The secretory pathway
2.1 The Structure & Functions of Eukaryotic Cells.
Golgi Apparatus & Lysosomes
How proteins get out of the Golgi apparatus? TGN.
E NDOMEMBRANOUS S YSTEMS By; Ayesha Shaukat. Functions of Rough ER  Many types of cells secrete proteins produced by ribosomes attached to rough ER.
Golgi complex, secretion and protein transport
Subcellular compartments that constitute the cellular endomembrane system. The major organelles of the endomembrane system are: the endoplasmic reticulum.
Protein Synthesis and Sorting: A Molecular View
Active Transport Processes
Intracellular Vesicular Traffic
Subcellular compartments that constitute the cellular endomembrane system. The major organelles of the endomembrane system are: the endoplasmic reticulum.
The Endomembrane system
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor
Intracellular Vesicular Traffic
Intracellular Compartments and Transport 2
structure & function of eukaryotic organelle
Organelles involved in synthesis and secretion of proteins
BIOLOGY, Faculty of Dentistry
Cell organelles.
Post-Translational Modification
Chapter 13 Intracellular Vesicular Traffic.
Presentation transcript:

Golgi complex BIOLOGY, Faculty of Medicine and Dentistry László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology Semmelweis University

Multiphoton fluorescence image of cultured HeLa cells

Camillo Golgi ( ) Nobel prize 1906 "internal reticular apparatus"

Structure Saccules Saccules Tubules Tubules Vesicles Vesicles structural-functional unit: dictyosome 4-6 saccles the structure is polarized into sub-compartments the structure is polarized into sub-compartments cis Golgimedial Golgi trans Golgi cis Golgimedial Golgi trans Golgi cis Golgi network (CGN) trans Golgi network(TGN)

Dictyosomes of the plant cells Synthesis of complex polysaccharides of the cell wall (hemicellulose, pectins)

Position cgi doi pnas freeadhesion patterninducedadhesion

Relation to the cytoskeleton

Main functions transport transport sorting sorting transformation transformation membrane wrapping membrane wrapping

Golgi – „Traffic manager” of the cell

Main pathways going in and out Golgi

Pulse-chase technique

dER Cisternaltransport Materials are forwarded together the cisterns together the cisterns Vesicular transport transport Vesicles trasport substances from cystern to cistern from cystern to cistern

Significance of cytoskeletal network

CGN the peptides arrive from the ER in vesicles the peptides arrive from the ER in vesicles they are N-glycosilated they are N-glycosilated no sorting in the ER no sorting in the ER Bidirectional transport of proteins: soluble, endogeneous proteins of the ER recycled soluble, endogeneous proteins of the ER recycled in transport vesicles - retention signal is required in transport vesicles - retention signal is required sorting and transport of lysosomal enzymes sorting and transport of lysosomal enzymes

Sorting and modification of lysosomal enzymes Mannose-6-phosphate (M-6-P) signaling: based on the recognition of lysosomal hydrolases based on the recognition of lysosomal hydrolases recognition of the “signal patches” (proper 3D combination recognition of the “signal patches” (proper 3D combination of amino acids) is required of amino acids) is required main working enzyme: GlcNAc-phosphotransferase main working enzyme: GlcNAc-phosphotransferase Phosphorylation of the mannoses: promotes the sorting of these enzymes promotes the sorting of these enzymes prevents the further modifications prevents the further modifications

N- and O- glycosylation

Glycosilation in the Golgi Modifications on the N-glycosilation pattern cis-Golgi: cis-Golgi: mannose-type oligosaccharides complex oligosaccharides TGN: TGN: substitution with sialic acids - negatively charged O-glycosilation: takes place mainly in the medial- and trans-Golgi takes place mainly in the medial- and trans-Golgi sidechains of Ser and Thr are glycosilated sidechains of Ser and Thr are glycosilated

© 2000 by Geoffrey M. Cooper

mannse phosphorylation (lysosomal prot.) Removal of mannose removal of mannose labelling w galactose Labelling w syalic acid Labelling w GlcNAc sorting CGN cis-Golgi medial-Golgi trans-Golgi TGN

Structure of M-6-P

Significance of M-6-P labelling

Other modifications glucose-amino-glycane (GAG) chains glucose-amino-glycane (GAG) chains sulphatation (proteoglycanes, Tyr res. of peptides) - TGN sulphatation (proteoglycanes, Tyr res. of peptides) - TGN proteolytic modifications - secretion vesicle proteolytic modifications - secretion vesicle

Synthesis of lipids in the Golgi ceramideglycolipidssphingomyelin

Main transport pathways from TGN

endosomal-lysosomal compartment endosomal-lysosomal compartment via transport vesicles - M-6-P receptors surface membrane - secretion surface membrane - secretion constitutive secretion - transports lipids and peptide components of the surface membrane and the extracellular matrix exocytosis exocytosis regulated secretion

acid phosphatase trans Golgi network osmium reduction cis-Golgi unstained Enzyme content of different compartments in Golgi

Modifications of secretory vesicles selective aggregation - TGN selective aggregation - TGN further modifications and sorting further modifications and sorting inactive precursor - active enzyme or hormone (e.g. preproinsulin - proinsulin - insulin) concentration - loss of water concentration - loss of water hydratation - e.g. proteoglygans hydratation - e.g. proteoglygans uptake some cytoplasmatic substances e.g. histamine uptake some cytoplasmatic substances e.g. histamine

Formation of the acrosome  Acrosome is a large lysosome and found in sperm  It contains enzymes e.g. hyaluronidase, acid phosphatase…  During the sperm differantiation several small vesicles (primary lysosomes) are formed from Golgi  thesmall vesicles are fused to form a single large lysosome - acrosome

Main pathway going out the Golgi

Alternative pathways some molecules do not synthesized on the rER some molecules do not synthesized on the rER (e.g. interleukin 1  and 1  - IL1  -IL1 , (e.g. interleukin 1  and 1  - IL1  -IL1 , basic fibroblast growth factor-bFGF) basic fibroblast growth factor-bFGF) these molecules transported by ABC-transporters these molecules transported by ABC-transporters other roles of the alternative pathway: other roles of the alternative pathway: - elimination of toxic proteins - regulation of protein concentrations in cytosol

Defects of sorting mechanism lysosomal enzymes do not enter the late endosomes BUT enzymes enter the constitutive secretory pathway and released I (=inclusion) cell disease: - the M-6-P signal is not formen on the enzymes - lysosomal enzymes “escape” from the cell - deficient intracellular digestion - the non-digested substances form INCLUSIONS

Golgi and the cell division

Network of membran flow in eukaryotic cells

Organell-dependent metabolism of lipids