Membrane Protein Production: 8/06/04 One target shipped: Lmaj000191: Mitochondrial ADP/ATP translocator in 2% octyl glucoside (predominant lower MW band).

Slides:

Advertisements

Similar presentations

Protein Purification Initial Questions How much and how pure?

Advertisements

Electrophoresis Theory

Membranes membranes are composed of a lipid bilayer and associated proteins ~1/3 of a cell's proteins are directly associated with membranes many soluble.

Manipulating molecules Biot-111 Lecture 4. Types of molecules Nucleic Acids –Deoxyribonucleic acid (DNA) Chromosomal DNA Mitochondrial DNA (mtDNA, or.

Regulators of Cell Cycle Progression (Literature Review) Prepared by Cai Chunhui.

AGEING CAN BE DEFINED AS THE PROGRESSIVE LOSS OF FUNCTION ACCOMPANIED BY DECREASING FERTILITY AND INCREASING MORTALITY.

NcRNA Structural 1.rRNA 2.tRNA 3.snRNA 4.snoRNA 5.cleavage: Rnases P & MRP, U3, snR30, etc Regulatory 1.Small siRNA miRNA 2.Long Activator Enhancer silencing.

Purification of bioengineered proteins CPSC 265 Week 12.

Last lecture: reversible phosphorylation regulation of transcription

Does the Chaperone SpcU Mask the Membrane Localization Domain of the Pseudomonas aeruginosa Type III Toxin ExoU? Presented by: Donald Rowen Work mainly.

Bio 98 - Lecture 4 Amino acids, proteins & purification.

Center for Human Genetics and Molecular Pediatric Disease

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

DNA Extraction And Purification BY Dr. Naglaa Fathy Lecturer of Biochemistry and Molecular Biology, faculty of medicine, Benha university Benha university2008.

Laboratory Activity Nine

Refolding of membrane proteins for structural studies Lars Linden * RAMC 2005.

Manufacture of Human Interleukin 13 Protein Using a Prokaryotic Expression System Ryan Rupp, York College of Pennsylvania, Department of Biological Sciences.

TYPES OF CLONING VECTORS

Microbial Biotechnology Philadelphia University

Regulating Eukaryotic Gene Expression. Why change gene expression? Different cells need different components Responding to the environment Replacement.

It's usually difficult to identify a protein of interest in a Commassie Blue-stained gel of cell extracts Coomassie Blue-stained gel MW stds. Cell extracts.

Engineering yeast to produce proteins for X-ray Crystallography: Heterologous Expression of L. MAJOR proteins in the yeast S. cerevisiae.

Mark Fang Stanford iGEM 08-09

DNA extraction.

Enzymology Lecture 5 by Rumeza Hanif. Why isolate enzymes? It is important to study enzymes in a simple system (only with small ions, buffer molecules,

Expression and Purification of Membrane Proteins from Leishmania major for Structural Genomics. Nadia Fedoriw, Kathy M. Clark, Sara M. Connelly, Katrina.

GO-Slim term Cluster frequency cytoplasm 1944 out of 2727 genes, 71.3% 70 out of 97 genes, 72.2% out of 72 genes, 86.1% out.

Chapter 11: Cell Communication. Cell to cell recognition: Yeast cells: secrete chemical signals which bind to specific receptors Start to grow towards.

Chapter 16 Microbial Genomics “If we should succeed in helping ourselves through applied genetics before vengefully or accidentally exterminating ourselves,

Taylor Bendt Faculty advisor: Dr. Gary Merrill. DNA Damage p53 DNA repairApoptosisp21 Cell cycle arrest Genome maintenance  Important for cancer prevention.

Plasmid Isolation Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250.

CCAGTTGCCGCGTTCACCCTCTCCTCATCCGCGGTTCACCGGCCTCGTTGAGACTGCCTG  SCO0033 GGCCGTCATTCCGACAGCACCCACGTCTCACTCCCCGTGCCCATGCGGGGACCGGGCGGC CCGGCAGTAAGGCTGTCGTGGGTGCAGAGTGAGGGGCACGGGTACGCCCCTGGCCCGCCG.

Lecture 2 blood bank PRINCIPLES OF ANTIGENS AND ANTIBODIES By Dr. Dalia Galal Hamouda.

Western blotting Pete Jones.

DNA extraction.

The Signal Hypothesis and the Targeting of Nascent Polypeptides to the Secretory Pathway Tuesday 9/ Mike Mueckler

Chapter 5.6+ Cellular Biology

The nature, significance, and glucagon-like peptide-1 analog treatment of brain insulin resistance in Alzheimer's disease Konrad Talbot, Hoau-Yan Wang

Glycogen metabolism.

Post Translational Modifications of Proteins

Target protein Additional file 3. SDS-PAGE showing the degree of purification of D1-26PtxtPL1-27 expressed in E. coli. PtxtPL1-27.

The effect of suppressing HIF1A on the expression of HIF2A

Detection of genetically modified plants By: Ehsan Zayerzadeh Standard Research Institute

Engineering yeast to produce proteins for X-ray Crystallography: Heterologous Expression of L. MAJOR proteins in the yeast S. cerevisiae.

Signals and Responses Cell Communication.

Volume 93, Issue 6, Pages (June 1998)

Cell Communication REVIEW.

Eukaryote Regulation and Gene Expression

Housekeeping May 1st 31 field trip, transport yourself to the Shady Lakes, pm. PCR results gel is posted (report) This lecture paper discussion.

Lipid raft-associated protein sorting in exosomes

Overview of Recombinant DNA Techniques

Direct Activation of Gastric H,K-ATPase by N-Terminal Protein Kinase C Phosphorylation. Comparison of the Acute Regulation Mechanisms of H,K-ATPase and.

Tyrosine Phosphorylation of Human Keratinocyte β-Catenin and Plakoglobin Reversibly Regulates their Binding to E-Cadherin and α-Catenin Peiqi Hu, Edward.

Epigenetic Control of MAGE Gene Expression by the KIT Tyrosine Kinase

The Relationship of MHC-Peptide Binding and T Cell Activation Probed Using Chemically Defined MHC Class II Oligomers Jennifer R Cochran, Thomas O Cameron,

Antigen Processing and Presentation

Oxidative Protein Folding Is Driven by the Electron Transport System

Volume 30, Issue 4, Pages (May 2008)

What is the major conclusion of this paper?

The nature, significance, and glucagon-like peptide-1 analog treatment of brain insulin resistance in Alzheimer's disease Konrad Talbot, Hoau-Yan Wang

Volume 104, Issue 4, Pages (February 2001)

HOW DO LIPID SOLUBLE HORMONES WORK???

Figure 2 Signalling downstream of the IL-6 receptor

E4-ORF1 binds endogenous PATJ and redistributes it into detergent-insoluble complexes in MDCK cells. E4-ORF1 binds endogenous PATJ and redistributes it.

Minoru Funakoshi, Robert J. Tomko, Hideki Kobayashi, Mark Hochstrasser

Volume 22, Issue 3, Pages (May 2006)

F.-Nora Vögtle, Chris Meisinger Developmental Cell

The Relationship of MHC-Peptide Binding and T Cell Activation Probed Using Chemically Defined MHC Class II Oligomers Jennifer R Cochran, Thomas O Cameron,

Epstein–Barr Virus Coopts Lipid Rafts to Block the Signaling and Antigen Transport Functions of the BCR Michelle L Dykstra, Richard Longnecker, Susan.

Presentation transcript:

Membrane Protein Production: 8/06/04 One target shipped: Lmaj000191: Mitochondrial ADP/ATP translocator in 2% octyl glucoside (predominant lower MW band). Other preps: Lmaj000776: (lost due to OG issues, see below) Lmaj001197: (oligomer on gel filtration) Detergent Issues: Protein instability in high octyl glucoside: Lmaj000766, one of our most stable ORFs appears to be rapidly completely degraded in octylglucoside (OG) above the CMC, but not below the CMC. Possible explanations: 1) co-purifying OG-activated protease; 2) OG-activated contamination in 3C protease; 3) oxidative damage via high OG. Successful preparations with nonyl glucoside and undecyl maltoside Limited availbility of Fos-choline 16 Lipid Issues: Extra blobs at bottom of gels are lipid Significant amounts of lipid are carried through purifications (detergent dependent) Added synthetic lipid (DOPC) does not significantly affect purification 3C protease supply for on-column cleavage: One-step-purified 3C works well for on-column cleavage (subject to OG issues, see above). Advantages of small membrane ORFs: LIC cloning of 7 smallest of 800 ORFs from Liz Worthey (truncated and full-length forms) >5/7 give detectable bands by Coomassie staining!

Pfal Protein expression in Tetrahymena Primers ordered for soluble protein expression: Soluble, expressed proteins: all have known inhibitors, none have been solved to date. PfAl006677WESPF14_0020Choline kinase PfAl008572WESPFE1430ccyclophilin-like PfAl005921WESPF11_0145Glyoxalase I PfAl005676WESPF10_0289Adensosine deaminase Proteins that expressed but were not soluble (from bacculo list) Pfal000348AAAPf358_t00001protein phosphatase-1 regulatory subunit 7 alpha2-related Pfal005915AAAPF11_0139protein tyrosine phosphatase, putative Pfal005766AAAPF10_0379phospholipase, putative Pfal008186AAAPFD0725carsenical pump-driving ATPase, putative Proteins that did not express (from synthetic gene list) PfAl006912AAAgi| |gb|AE | exosome component PfAl007889AAAgi| |ref|NP_ |possible dual specificity phosphatase (Note: NNNN…) PfAl006547AAAgi| |ref|NP_ |Topoisomerase III (Note: NNNKKK…) PfAl007173AAAgi| |ref|NP_ |Probable peptidase (Note: NNNKKK…) PfAl005232AAAgi| |ref|NP_ | methyl transferase (Note: NNNKKK…)

Primers being ordered for membrane and secreted protein expression in Tetrahymena: LocusFunction/Target rationaleAAs MAL7P1.27pfcrt (choroquine resist) 424 PFE1150wmdr1 (drug resist)1419 PFE1265wGPCR? 467 Pf13_0248pf47 antigen 439 PFB0405s230 antigen3135 AAF pfs25 antigen 217 AAT pfs28 antigen 218 PF11_0486MAEBL eryth binding antigen2055 PFA0125cEbl1 erythrocyte binding antigen1567 PFL1315wpfkch1 K+channel1979 PFI0955wput. Hexose transporter 476 PFA0310cCa+ATPase (atemisinin target)1228