DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) THE CELL.

Slides:



Advertisements
Similar presentations
CSCE555 Bioinformatics Lecture 3 Gene Finding Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:
Advertisements

Question and Answer Samples and Techniques
Cell parts Biology I Cell animation:
Prof. Drs. Sutarno, MSc., PhD.. Biology is Study of Life Molecular Biology  Studying life at a molecular level Molecular Biology  modern Biology The.
CELL ORGANELLES. MITOCHONDRIA  Creates energy for the cell using cellular respiration  Found floating in the cytoplasm  Has of two membranes  Cell.
Intro to Molecular Genetics RNA & Protein Synthesis 3/16/2011.
1 Central Dogma: Review of Transcription and Translation in bacteria.
What’s the central dogma of biology?
Directed Reading: “Cell Organelles”
What was the most interesting thing that you did over Winter Break? Create a double bubble map comparing/contrasting DNA and RNA.
KEY WORDS – CELLS, DNA, INFORMATION All living things are made from Deoxyribonucleic acid is abbreviated This molecule stores that helps cells carry.
Which type of code is read to create a sequence of amino acids? a- tRNA b-mRNA c-DNA d-rRNA.
RNA and Protein Synthesis
Cell Biology Ged Palmer. What is a cell A cell is a block of life Functional unit of all living organisms.
Express yourself That darn ribosome Mighty Mighty Proteins Mutants RNA to the Rescue
2. Why do cells make proteins?
From DNA to Proteins Lesson 1. Lesson Objectives State the central dogma of molecular biology. Describe the structure of RNA, and identify the three main.
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
Function of Cell Organelles. Each cell organelle has a different function All organelles within a cell work together to ensure that the cell functions.
Nucleolus Makes ribosomes in the nucleus. Chromatin  Contains DNA; coils into chromosomes.
© 2010 McGraw-Hill Australia The Cell Chapter 2 - Cellular activity.
Chapter 13.2 Ribosomes and Protein Synthesis
 All organisms are composed of cells  Cells are the smallest living unit of living things  All cells come from cells The Cell Theory Spontaneous generation.
VII RNA and Protein Synthesis
CENTRAL DOGMA OF BIOLOGY. Transcription & Translation How do we make sense of the DNA message? Genotype to Phenotype.
Which of the Following Organelles Makes Membrane? A. Golgi apparatus B. Nucleus C. Ribosome D. Endoplasmic reticulum.
13.2 Ribosomes and Protein Synthesis
Chapter 13: RNA and Protein Synthesis
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
RNA and Protein Synthesis
National 5 Biology Course Notes Part 4 : DNA and production of
What is the job of p53? What does a cell need to build p53? Or any other protein?
The Genetic Code.
Unit 5: Molecular Genetics. DNA Transcription Translation TraitRNA Protein The “Central Dogma” of Molecular Genetics.
Molecular Genetics - From DNA to Trait. How Are Different Types of Cells Created and Maintained? Different types of cells are created by differential.
Chapter 18 Gene Expression & Protein Synthesis Chemistry 20.
CELLULAR FUNCTIONS SB1 3C – CELLULAR BIOLOGY.
Eukaryotic Cell Structure. Eukaryotic Cells Have a nucleus Found in plants, animals, and some unicellular organisms ANIMAL CELLPLANT CELL SINGLE-CELLED.
Lesson Overview Lesson Overview Ribosomes and Protein Synthesis Objectives 13.2 Ribosomes and Protein Synthesis - Identify the genetic code and explain.
Name that Organelle!.
Cell Structure. Cell Organelles Little organs- carry out life processes in the cell.
3.A.1 DNA and RNA Part IV: Translation DNA, and in some cases RNA, is the primary source of heritable information. DNA, and in some cases RNA, is the primary.
Transcription and Translation
Protein Production HPVGardasilMoleculesCell Parts.
Unit 3 Exam Review Honors Biology. Matching A.Chloroplasts B. Mitochondria C. Nucleus D. Central vacuole E. Rough ER F. Ribosome G. Cell Membrane H. Lysosome.
The Making of Proteins Using the Genetic Information Stored in DNA
Protein Synthesis How genes work.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Introduction to Molecular Biology and Genomics BMI/CS 776 Mark Craven January 2002.
Ribosomes and Protein Synthesis. Learning Objectives  Identify the genetic code and explain how it is read.  Summarize the process of translation. 
Unit 4: Genetic Information, Variation and Relationships between Organisms Lesson 1 Genetic Organisation IN PROKARYOTIC CELLS, DNA MOLECULES ARE SHORT,
Transcription and The Genetic Code From DNA to RNA.
OBJECTIVE 11 NOTES. Explain the evolutionary significance of a nearly universal genetic code.
Cell Structure and Function. Animal Cell Plant Cell.
Intermediate filaments Motors Protein –U–Use energy (ATP) –C–Connect cytoskeleton to self and to vesicle Myosin Dynein and Kinesin (microtubules)
Protein Synthesis The Making of Proteins Using the Genetic Information Stored in DNA.
Protein Synthesis The Making of Proteins Using the Genetic Information Stored in DNA.
Organelles Organelles do the work of cells
Regents Biology 2. Cells need workers = proteins!  Making proteins  to run daily life & growth, the cell must…  read genes (DNA)  build proteins 
Part 5 Translation.
Cell parts Cell animation:
The ABC’s of DNA Barry Bowman.
Mitochondria are in both cells!!
Protein Synthesis in Detail
________________________ processes proteins makes membranes
cytoplasm jelly-like material holding organelles in place
Cell parts Biology I Cell animation:
Continuation: translation
cytoplasm jelly-like material around organelles central vacuole
Presentation transcript:

DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) THE CELL

DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) Ribosomes, membrane network – Manufacturing center for proteins and membranes THE CELL

DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) Ribosomes, membrane network – Manufacturing center for proteins and membranes Mitochondria – Energy production in the form of ATP THE CELL ATP

DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) Ribosomes, membrane network – Manufacturing center for proteins and membranes Mitochondria – Energy production in the form of ATP Lysosomes - Recycling and storage of molecules THE CELL ATP

The Central Dogma of Molecular Biology DNA RNA Protein

DNA Structure

The Genetic Code Three letters make a “word” (specify an amino acid) ATG means start, with the amino acid methionine TAA or TAG or TGA means stop MetArgCysAlaGlnCysHisThrLeuGluGluGlyGlyGlyAsn ATGCGTTGCGCTCAGTGCCACACCCTTGAGGAGGGCGGCGGCAACTAA AUGCGUUGCGCUCAGUGCCACACCCUUGAGGAGGGCGGCGGCCAACUAA DNA RNA PROTEIN

Lysozyme

Our Course Bill Saxton Al Zahler Karen Otteman Molecular motors, Biology of cancer cells Helicobacter and transport in cells gene splicing human disease

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.