tools for synteny analysis

Slides:



Advertisements
Similar presentations
In Silico Primer Design and Simulation for Targeted High Throughput Sequencing I519 – FALL 2010 Adam Thomas, Kanishka Jain, Tulip Nandu.
Advertisements

Introduction 1.Ordering of P. knowlesi contigs v P. falciparum methodology progress/status towards a synteny map – ‘true’ scaffold 2. Gene prediction generating.
Two sequences Multiple sequences Local Blastz (zPicture-dcode.org) ALIGNMENTCONVERVED TFBS LAGAN (mVISTA) Global TBA/Multiz (Mulan-dcode.org) Local rVISTA.
Blast outputoutput. How to measure the similarity between two sequences Q: which one is a better match to the query ? Query: M A T W L Seq_A: M A T P.
Objective Understand web-based digital media production methods, software, and hardware. Course Weight : 10%
MapSynteny: Software to create images of synteny 1 Sugarbeet and Bean Research Unit, Agricultural Research Service, United States Department of Agriculture,
Comparative genomics Joachim Bargsten February 2012.
GenomePixelizer - a visualization tool for comparative genomics within and between species. A. Kozik, E. Kochetkova, and R. Michelmore (Department of Vegetable.
Peter Tsai, Bioinformatics Institute.  University of California, Santa Cruz (UCSC)  A rapid and reliable display of any requested portion of genomes.
Panzea Graphical Map Viewer Tutorial With the Panzea graphical map viewer you can construct custom graphical displays of the map positions.
Kate Milova MolGen retreat March 24, Microarray experiments: Database and Analysis Tools. Kate Milova cDNA Microarray Facility March 24, 2005.
CS273a Lecture 10, Aut 08, Batzoglou Multiple Sequence Alignment.
Kate Milova MolGen retreat March 24, Microarray experiments. Database and Analysis Tools. Kate Milova cDNA Microarray Facility March 24, 2005.
Sequence Comparison Intragenic - self to self. -find internal repeating units. Intergenic -compare two different sequences. Dotplot - visual alignment.
Genomic Rearrangements CS 374 – Algorithms in Biology Fall 2006 Nandhini N S.
Visual Publisher Overview and Demo Mike Macomber Manager, Solutions Consulting.
IBIS GIS Mapping Missouri “Show and Tell”. Outline 1.What is KML 2.Why we chose KML 3.Show and Tell.
Sequencing a genome (a) outline the steps involved in sequencing the genome of an organism; (b) outline how gene sequencing allows for genome-wide comparisons.
Whole genome alignments Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas
SQL Server Reporting Services
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
© Wiley Publishing All Rights Reserved.
Mouse Genome Sequencing
Title: GeneWiz browser: An Interactive Tool for Visualizing Sequenced Chromosomes By Peter F. Hallin, Hans-Henrik Stærfeldt, Eva Rotenberg, Tim T. Binnewies,
Tutorial 1 Getting Started with Adobe Dreamweaver CS3
Comparative Genomics Tools in GMOD GMOD.org Dave Clements 1, Sheldon McKay 2, Ken Youns-Clark 2, Ben Faga 3, Scott Cain 4, and the GMOD Consortium 1 National.
1 The Genome Browser allows you to –Browse the Rice-Japonica, Maize and Arabidopsis genomes. –View the location of a particular feature on the rice genome.
GENOME-CENTRIC DATABASES Daniel Svozil. NCBI Gene Search for DUT gene in human.
Copyright OpenHelix. No use or reproduction without express written consent 2 Overview of Genome Browsers Materials prepared by Warren C. Lathe, Ph.D.
Genome Alignment. Alignment Methods Needleman-Wunsch (global) and Smith- Waterman (local) use dynamic programming Guaranteed to find an optimal alignment.
GMOD/GBrowse_syn Sheldon McKay iPlant Collaborative DNA Learning Center Cold Spring Harbor Laboratory.
Web Apollo and the VectorBase user community Gloria I. Giraldo-Calderón March 31, 2015.
GMOD: Managing Genomic Data from Emerging Model Organisms Dave Clements 1, Hilmar Lapp 1, Brian Osborne 2, Todd J. Vision 1 1 National Evolutionary Synthesis.
Apollo Future Plans Nomi Harris, BDGP/FlyBase GMOD Meeting, Cambridge April 27, 2004.
ANALYSIS AND VISUALIZATION OF SINGLE COPY ORTHOLOGS IN ARABIDOPSIS, LETTUCE, SUNFLOWER AND OTHER PLANT SPECIES. Alexander Kozik and Richard W. Michelmore.
Welcome to DNA Subway Classroom-friendly Bioinformatics.
Browsing the Genome Using Genome Browsers to Visualize and Mine Data.
VISTA family of computational tools for comparative genomics How can we leverage genome sequences from many species to learn about genome function?How.
Construction of Substitution Matrices
Identifying conserved segments in rearranged and divergent genomes Bob Mau, Aaron Darling, Nicole T. Perna Presented by Aaron Darling.
GMOD/GBrowse_syn Sheldon McKay Reactome Ontario Institute for Cancer Research.
GBrowse Population Display and CMap SMBE 2009 Ben Faga.
Orthology & Paralogy Alignment & Assembly Alastair Kerr Ph.D. [many slides borrowed from various sources]
Lettuce/Sunflower EST CGPDB project. Data analysis, assembly visualization and validation. Alexander Kozik, Brian Chan, Richard Michelmore. Department.
数据库使用 杨建华 2010/9/28. Outline of the Topics UCSC and Ensembl Genome Browser (Blat vs Blast vs Blastz vs Multiz) 挖掘数据用 Table Browser 或 BioMart 用户友好化你的数据.
Copyright OpenHelix. No use or reproduction without express written consent1.
Orthology & Paralogy Alignment & Assembly Alastair Kerr Ph.D. WTCCB Bioinformatics Core [many slides borrowed from various sources]
ARGOS (A Replicable Genome InfOrmation System) for FlyBase and wFleaBase Don Gilbert, Hardik Sheth, Vasanth Singan { gilbertd, hsheth, vsingan
A Parallel, High Performance Implementation of the Dot Plot Algorithm Chris Mueller July 8, 2004.
Construction of Substitution matrices
Copyright OpenHelix. No use or reproduction without express written consent1.
Tools in Bioinformatics Genome Browsers. Retrieving genomic information Previous lesson(s): annotation-based perspective of search/data Today: genomic-based.
Accessing and visualizing genomics data
Comparative Genomics with GBrowse_syn Sheldon McKay.
Welcome to the combined BLAST and Genome Browser Tutorial.
GMOD/GBrowse_syn Sheldon McKay iPlant Collaborative DNA Learning Center Cold Spring Harbor Laboratory.
Visualizing data from Galaxy
Draft genome of Cicer reticulatum L., the wild progenitor of chickpea
Canadian Bioinformatics Workshops
Behavior and Phenotype in GMOD Natural Diversity in GMOD
Lettuce/Sunflower EST CGPDB project.
By Chunfang Zheng and David Sankoff, 2014
INFORMATION FLOW AARTHI & NEHA.
Mattew Mazowita, Lani Haque, and David Sankoff
Ensembl Genome Repository.
Comparative Genomics.
Updates and Future Direction
About CGD/ Getting Started
Welcome - webinar instructions
Visualization of Conserved Syntenic Blocks Among Six Cotton Genomes in CottonGen Ping Zheng, Sook Jung, Chun-Huai Cheng, Jing Yu, Heidi Hough, Josh Udall,
Presentation transcript:

tools for synteny analysis

… synteny "on the same ribbon" sensu stricto - no gene order information collinearity – recognizable (imperfect) synteny <-> conserved synteny syntenic chromosomes, syntenic blocks, perfect ~ imperfect synteny, thresholds???

… outline scales of synteny why care about synteny? categories of tools examples recommendations

… my experience LAF2 LAF13 human

… why bother? aid genome assembly and annotation through alignments of orthologous regions study large-scale rearrangements trace genome evolution identify functional elements (enhancers, …)

… orders of magnitude macrosynteny whole genome translocations, fusions, … reducing complexity graphically coarse, neglecting smaller imperfections ? microsynteny gene level homology visualizations domain-, exon-alignments alignments of multiple species

… excellent tools standalone <-> web services more than 20 software packages 5 or more web based tools (3 run user data: GSV, AutoGraph, Cinteny)

… tools BLASTZ, LAST, MULTIZ, Shuffle-LAGAN all-in-one <-> requiring prior alignments all-in-one solutions: Mauve (Aaron Darling) Symap CoGe syn (for published genomes) prior alignments: BLASTZ, LAST, MULTIZ, Shuffle-LAGAN

… categories micro & macro synteny: Mizbee, Symap, Cinteny, CoGe Synmap, Sybil, … micro synteny: Synbrowse, GBrowse_syn, SynView, GSV, AutoGraph, Phytozome, Vistapoint, … interactive dot plot: GenoPix 2D Plotter assembly tools: Oslay, CoGe Syn

… blast & excel John Bowers

17 18

… MizBee (cs.utah.edu/~miriah/mizbee) integrated and interactive synteny visualization on three scales documentation on setup is missing

… SyMap agcol.arizona.edu/software/symap all-in-one solution dot-plots 2D and 3D synteny plots interactive filtering

… vitis/tomato in SyMap

… “blocks only” in SyMap

filtering in SyMap tomato chr.1 vs. vitis

lettuce LG7 vs. vitis

… 2D plot in Symap lettuce LG7 vs. vitis

… 3D plot in Symap

… McScan http://chibba.pgml.uga.edu/duplication/mcscan/ microsynteny calculation and visualization lettuce/potato comparison (BGI)

Gbrowse related synteny viewer Synbrowse synbrowse.org SynView gmod.org/wiki/SynView works in GBrowse GBrowse_syn gmod.org/wiki/GBrowse_syn still developed

… GBrowse_syn (distantly related species?)

Genome Synteny Viewer cas-bioinfo.cas.unt.edu/gsv/homepage.php - webservice and standalone download for micro-synteny - excellent video tutorials - works only with small datasets ?

GENOMICUS http://www.dyogen.ens.fr/genomicus for beasts only

GENOMICUS http://www.dyogen.ens.fr/genomicus

Genomicus webserver for animal synteny gene level comprehensive summarizes clade characteristics

compositaezome.phytozome.net

… phytozome micro-synteny

atgc.org/GenoPix_2D_Plotter GenoPix 2D Plotter interactive Alex Kozik

… Cinteny cinteny.cchmc.org: - webservice - simple file format - whole genome to gene level scale - adjustable syteny block thresholds

Cinteny - gene level plots

Cinteny: - variation due to gap length and min. length parameters

Cinteny: whole genome cpomparisons

AutoGraph autograph.genouest.org generates high resolution synteny maps calculates synteny blocks (threshold options) and numbers of rearrangements

… Vistapoint LBNL/JGI group genome.lbl.gov/vista microsynteny only

… Vistapoint dot plots published genome sequences

… CoGe synteny tools synteny.cnr.berkeley.edu/CoGe CONs: - no circle plots (humor alert) - it is complex PROs: - this is a treasure chest !!!

… whole genome dot plots

… ks histogram in CoGe

… custom analysis in CoGe choice of alignment algorithms, …

… custom analysis in CoGe it may take a few hours

OSLAY http://ab.inf.uni-tuebingen.de/software/oslay/ ordering of conserved blocks according to synteny synthesis of incomplete assemblies of related species bacterial genomes only ?

OSLAY synthesis of two incomplete assemblies of related species

… syntenic path assembly option in CoGe SynMap

… our lettuce data Symap (vitis, tomato) Cynteny Blast/Excel method sunflower, lettuce/lettuce improve pseudomolecules ?

… preliminary recommendations comparing published plant genomes: - explore CoGe’s tools pre-publication data analysis: - Symap and Mizbee have lots of tempting features, but John’s Excel tabulation works should have tried MacScan hosting own genome browser: - Gbrowse-Syn