DNA Structure & Replication 1

2

3 DNA DNA.DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins within the cell.

4 DNA Why do we study DNA? We study DNA for many reasons, e.g., its central importance to all life on Earth, medical benefits such as cures for diseases, better food crops.

5 Chromosomes and DNA Our genes are on our chromosomes. Chromosomes are made up of a chemical called DNA.

6 The Shape of the Molecule DNA is a very long polymer. The basic shape is like a twisted ladder or zipper. This is called a double helix.

7 The Double Helix Molecule Discovered by James Watson & Francis Crick The DNA double helix has two strands twisted together.

8 One Strand of DNA The backbone of the molecule is alternating phosphates and deoxyribose sugar The teeth are nitrogenous bases. phosphate deoxyribose bases

9 Nucleotides CC C O Phosphate O C C O -P O O O O O O O One deoxyribose together with its phosphate and base make a nucleotide. Nitrogenous base Deoxyribose

10 One Strand of DNA One strand of DNA is a polymer of nucleotides. One strand of DNA has many millions of nucleotides. nucleotide

11 Four nitrogenous bases Cytosine C Thymine T Adenine A Guanine G DNA has four different bases:

12 Two Stranded DNA Remember, DNA has two strands that fit together something like a zipper. The teeth are the nitrogenous bases but why do they stick together?

13 C C C C N N O N C C C C N N O N N N C Hydrogen Bonds The bases attract each other because of hydrogen bonds. Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA. The bonds between cytosine and guanine are shown here with dotted lines

14 Hydrogen Bonds, Hydrogen Bonds, cont. When making hydrogen bonds, cytosine always pairs up with guanine Adenine always pairs up with thymine Adenine is bonded to thymine here C C C C N N N N N C C C C C N N O O C

15 Chargaff’s Rule: Adenine and Thymine always join together A T Cytosine and Guanine always join together C G

16 DNA by the Numbers Each cell has about 2 m of DNA. The average human has 75 trillion cells. The average human has enough DNA to go from the earth to the sun more than 400 times. DNA has a diameter of only m. The earth is 150 billion m or 93 million miles from the sun.

17 DNA Replication

18 Replication Facts DNA has to be copied before a cell dividesDNA has to be copied before a cell divides DNA is copied during the S or synthesis phase of interphaseDNA is copied during the S or synthesis phase of interphase New cells will need identical DNA strandsNew cells will need identical DNA strands

19 Synthesis Phase (S phase) S phase during interphase of the cell cycle Nucleus of eukaryotes Mitosis -prophase -metaphase -anaphase -telophase G1G1 G2G2 S phase interphase DNA replication takes place in the S phase.

20 DNA Replication Begins at Origins of ReplicationBegins at Origins of Replication Two strands open forming Replication Forks (Y-shaped region)Two strands open forming Replication Forks (Y-shaped region) New strands grow at the forksNew strands grow at the forks ReplicationFork Parental DNA Molecule 3’ 5’ 3’ 5’

21 DNA Replication As the 2 DNA strands open at the origin, Replication Bubbles formAs the 2 DNA strands open at the origin, Replication Bubbles form Prokaryotes (bacteria) have a single bubble Eukaryotic chromosomes have MANY bubbles Bubbles

22 DNA Replication Enzyme Helicase unwinds and separates the 2 DNA strands by breaking the weak hydrogen bondsEnzyme Helicase unwinds and separates the 2 DNA strands by breaking the weak hydrogen bonds

23 Question: What would be the complementary DNA strand for the following DNA sequence? DNA 5’-CGTATG-3’

24 Answer: DNA 5’-CGTATG-3’ DNA 3’-GCATAC-5’

25

26 PROTEIN SYNTHESIS

DNA and Genes

DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells

29 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist

30 Amino Acid Structure

31 Polypeptides Amino acid chains are called polypeptides

32 DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER

33 Starting with DNA DNA ‘s code must be copied and taken to the cytosolDNA ‘s code must be copied and taken to the cytosol In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins)In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESISThis process is called PROTEIN SYNTHESIS

RNA

35 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan

36 RNA Differs from DNA RNA has a sugar riboseRNA has a sugar ribose DNA has a sugar deoxyribose

37 Other Differences RNA contains the base uracil (U)RNA contains the base uracil (U) DNA has thymine (T) RNA molecule is single-strandedRNA molecule is single-stranded DNA is double- stranded DNA

38 Structure of RNA

39. Three Types of RNA Messenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomesMessenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized

40 Messenger RNA Long Straight chain of Nucleotides Made in the Nucleus Copies DNA & leaves through nuclear pores Contains the Nitrogen Bases A, G, C, U ( no T )

41 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

42 Ribosomal RNA (rRNA) rRNA is a single strand 100 to 3000 nucleotides longrRNA is a single strand 100 to 3000 nucleotides long Globular in shapeGlobular in shape Made inside the nucleus of a cellMade inside the nucleus of a cell Associates with proteins to form ribosomesAssociates with proteins to form ribosomes Site of protein SynthesisSite of protein Synthesis

43 The Genetic Code A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating

44 The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine

45 Name the Amino Acids GGG? UCA? CAU? GCA? AAA?

46 Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U C-G

47 Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon

48 Transfer RNA amino acid attachment site UAC anticodon

49 Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA UGA ACU

Transcription and Translation

51 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

52 Protein Synthesis   The production or synthesis of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA must be processed before it leaves the nucleus of eukaryotic cells

53 DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

54

55 Transcription The process of copying the sequence of one strand of DNA, the template strand mRNA copies the template strand Requires the enzyme RNA Polymerase

56 Template Strand

57 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

58 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

59 Transcription During transcription, RNA polymerase binds to DNA and separates the DNA strands RNA Polymerase then uses one strand of DNA as a template to assemble nucleotides into RNA

60 Transcription Promoters are regions on DNA that show where RNA Polymerase must bind to begin the Transcription of RNA Called the TATA box Specific base sequences act as signals to stop Called the termination signal

61 RNA Polymerase

62 mRNA Processing After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional Introns, non-functional segments of DNA are snipped out of the chain

63 mRNA Editing Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase A guanine triphosphate cap is added to the 5’ end of the newly copied mRNA A poly A tail is added to the 3’ end of the RNA The newly processed mRNA can then leave the nucleus

64 CAP Tail New Transcript Result of Transcription

65 mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes

66

67

68 Translation Translation is the process of decoding the mRNA into a polypeptide chain Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins

69 Transcription Translation

70 Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A

71 Step 1- Initiation mRNA transcript start codon AUG attaches to the small ribosomal subunit Small subunit attaches to large ribosomal subunit mRNA transcript

72 Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

Step 2 - Elongation As ribosome moves, two tRNA with their amino acids move into site A and P of the ribosome Peptide bonds join the amino acids

74 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

75 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

76 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

77 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

78 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

79 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

80 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

81 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

82 End Product –The Protein! The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

83

84 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

Protein Synthesis 85