Advantages of STR Analysis

Slides:

Advertisements

Similar presentations

Brief History of Forensic DNA Typing

Advertisements

DNA: Review, Replication, & Analysis Two types of DNA Nucleic DNA –Found in the nucleus of a cell –Specific to an individual Mitochondrial DNA (mtDNA)

DNA Analysis Chapter 12. General DNA Information Double helix—two coiled DNA strands Composed of nucleotides—units containing a sugar molecule (deoxyribose),

DNA Fingerprinting and Forensic Analysis Chapter 8.

DNA Fingerprinting and Forensic Analysis

Explain how crime scene evidence is

13-2 Manipulating DNA.

Biotech Continued… How do forensic scientists determine who’s blood has been left at a crime scene? How do forensic scientists determine who’s blood.

“The capacity to blunder slightly is the real marvel of DNA. Without this special attribute, we would still be anaerobic bacteria and there would be no.

Chapter 6 Biology of STRs: Stutter Products, Non-template Addition, Microvariants, Null Alleles, and Mutation Rates ©2002 Academic Press.

Advanced Molecular Biological Techniques. Polymerase Chain Reaction animation.

Introduction to DNA DNA Fingerprinting and the Polymerase Chain Reaction.

DNA Fingerprinting Catalyst: What are polymorphisms?

6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.

DNA. A. Terminology A. Terminology Chromosomes- strands of genetic material Chromosomes- strands of genetic material Genes- Fundamental unit of heredity.

1 Chapter 7 Chapter 7 DNA Fingerprinting Learning Goals: o Explain how crime scene evidence is collected and processed to obtain DNA o Describe how radioactive.

Ch. 13.4: DNA Technology Applications

DNA Fingerprinting or DNA Profiling

DNA in the Cell chromosome cell nucleus Double stranded DNA molecule Individual nucleotides PCR, stands for? Polymerase Chain Reaction.what is it? Invented.

DNA Technology Chapter 20.

DNA fingerprinting. DNA fingerprinting is used to determine paternity Look at the DNA of the mother, father and child Could these parents produce this.

Applications of DNA technology

Genetics Techniques: RFLP & PCR AP Biology Unit 3.

Manipulating DNA.

What do these terms mean to you? You have 5 min to discuss possible meanings and examples with your group! DNA sequencing DNA profiling/fingerprinting.

Qai Gordon and Maddy Marchetti. What is Polymerase Chain Reaction? Polymerase Chain Reaction ( PCR ) is a process that amplifies small pieces of DNA to.

Polymerase Chain Reaction PCR. PCR allows for amplification of a small piece of DNA. Some applications of PCR are in: –forensics (paternity testing, crimes)

Forensics DNA Unit Test. DNA typing had its beginnings in 1985 with the work of: Sir Alec Jeffries.

Crime Scene Investigator PCR Basics™

Genetics 6: Techniques for Producing and Analyzing DNA.

RFLP Analysis Restriction Fragment Length Polymorphism 1.Extract/Isolate DNA from the cell restriction enzymes 2.Cut DNA into smaller fragments using restriction.

Gel Electrophoresis A molecular biology tool. Purpose To separate and analyze/compare fragments of DNA.

Success criteria - PCR By the end of this lesson we will be able to: 1. The polymerase chain reaction (PCR) is a technique for the amplification ( making.

Highlights of DNA Technology. Cloning technology has many applications: Many copies of the gene are made Protein products can be produced.

Chapter 11 Kendall/Hunt Publishing Company0 DNA Introduction (Continued)

GENE SEQUENCING. INTRODUCTION CELL The cells contain the nucleus. The chromosomes are present within the nucleus.

6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.

Chapter 10: Genetic Engineering- A Revolution in Molecular Biology.

DNA testing creates patterns unique to each individual. Key Idea:

Forensic DNA Analysis Basic Review 46 chromosomes per cell, 23 pairs Humans have approximately 25,000 genes Each gene has multiple versions,

Molecular Genetic Technologies Gel Electrophoresis PCR Restriction & ligation Enzymes Recombinant plasmids and transformation DNA microarrays DNA profiling.

DNA Analysis We will learn:

Crime Scene Investigator PCR Basics™

PCR Y.Martinez, LSHS, 2014 DIRECTIONS: COPY NOTES IN ORANGE.

Introduction to PCR Polymerase Chain Reaction

Forensic Science DNA Analysis 1. History of Biological Evidence in Forensics  DNA fingerprinting  Also known as DNA profiling  Used with a high degree.

Higher Human Biology Unit 1 Human Cells KEY AREA 5: Human Genomics.

Polymerase Chain Reaction (PCR). What’s the point of PCR? PCR, or the polymerase chain reaction, makes copies of a specific piece of DNA PCR allows you.

Forensic Science DNA Fingerprinting Uniqueness of fingerprinting led many to believe can demonstrate guilt or innocence of a suspect –Can alter fingerprints.

 Types of STR markers- 5 types based on sequence  STR allele nomenclature  Allelic ladder  Serological methods of identity profiling  Identity profiling.

PCR Polymerase chain reaction. PCR is a method of amplifying (=copy) a target sequence of DNA.

DNA Fingerprinting.

DNA Forensics 352 – O’Dette. Why DNA? DNA is individual evidence DNA links or eliminates a suspect to a crime DNA identifies a victim even if no body.

DNA Fingerprinting Review. Why DNA? DNA is individual evidence DNA links or eliminates a suspect to a crime DNA identifies a victim even if no body is.

Aim: What are some techniques used in DNA engineering?

Introduction to PCR Polymerase Chain Reaction

Gel Electrophoresis Technique for separating DNA molecules based on size Load DNA mixture into gel containing pores of varying sizes Subject DNA to electric.

Success criteria - PCR By the end of this lesson we will be know:

PCR and Gel Electrophoresis

Today’s Title: CW: DNA manipulation – separating and probing

Forensic Science DNA Analysis

Sequencing and Copying DNA

Polymerase Chain Reaction (PCR)

Introduction to Polymerase Chain Reaction (PCR)

History of DNA Fingerprinting

Biotechnology Part 2.

CHAPTER 13 DNA: The Indispensable Forensic Science Tool

SBI4U0 Biotechnology.

Presentation transcript:

Advantages of STR Analysis Compares specific genetic markers, not whole genome. Can be used for tiny samples or degraded samples because it makes many copies of sample.

STR Analysis Procedure 1. Isolate DNA 2. Polymerase Chain Reaction (PCR) Amplify (make copies) of specific loci 3. Electrophoresis - Sort fragments 4. Visualize fragments - can use various methods: Southern Blot, Stain Gel & UV Light, Fluorescent Tags

STEP 1. Extract DNA from cell Break cell membrane – release nucleus Open nucleus - release DNA protect DNA from enzymes Separate from other cell parts DNA must be precipitated un-dissolved from solution

STEP 2. PCR Procedure Heat DNA - strands unzip (denature) 2. Cool 3. Add - Primers - “starter pieces” of DNA bind (anneal) - to complementary sequences at beginning of specific loci - DNA polymerase - “replicator machine” - Nucleotides (AGCT) building blocks 4. Heat to 75° C – DNA polymerization

DNA Amplification with Polymerase Chain Reaction (PCR) Separate strands (denature) 5’ 3’ Starting DNA Template 5’ 3’ Add primers (anneal) 5’ 3’ Forward primer Reverse primer 5’ 3’ Make copies (extend primers)

Polymerase Chain Reaction GCTATTCTGGGAGTCCAGAGTGGACGT CGATAAGACCCTCAGGTCTCACCTGCA CAC TGG A C G A T G C T

PCR Copies DNA Exponentially through Multiple Thermal Cycles Original DNA target region Thermal cycle Thermal cycle Thermal cycle In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created Each cycle takes less than 2 minutes from start to finish.

STEP 3. Electrophoresis

STEP 4. Visualization of STR Alleles Southern Blot & Autoradiography – with radioactive probes & X-ray. Gel may be stained and visualized with UV light after electrophoresis is complete. Fluorescent tags can be added to primer before running gel. AATG GCTCATA CTAATGCCCGTA

Fluorescent dye labels AATG GCTCATA CTAATGCCCGTA GCTCATA AATG AATG CTAATGCCCGTA GCTCATA AATG AATG AATG CTAATGCCCGTA GCTCATA AATG AATG AATG AATG CTAATGCCCGTA GCTCATA AATG AATG CTAATGCCCGTA For a specific loci there are many different alleles Each allele varies in length due to the number of STR’s in the middle of the segment

How many loci were tested for each individual? Each person has 2 alleles for a locus. M/D The resulting pattern of an STR sequence for a single locus has either 1 or 2 bands Can be homozygous or heterozygous for each locus. 1 band = homozygous – both fragments same length 2 bands = heterozygous – different fragment lengths 13 repeats 12 repeats 11 repeats 10 repeats 9 repeats 12 repeats 8 repeats 7 repeats 6 repeats 5 repeats 4 repeats 3 repeats How many loci were tested for each individual?

An autoradadiogram has several lanes containing DNA ladders. Each band in these lanes contains a known length of DNA - # of base pairs Used for comparison to determine the length of unknown DNA bands in other lanes. Determine # bp - Use to determine # of STR repeats

To be a match - every fragment must match up.

Should this person be convicted of rape? Rape cases separate male faction (sperm) DNA from female faction (epithelial) DNA compare with DNA from blood Should this person be convicted of rape?

How many loci were tested for each individual? Paternity cases can be used to determine the parents of a child, to identify a child’s remains, in sibling analysis and inheritance right cases. How many loci were tested for each individual? Is each child the biological offspring of both parents? Remember, each line represents one allele. Each allele for each child is inherited from one of his/her parents.

FBI’s CODIS DNA Database Combined DNA Index System Links serial crimes & unsolved cases with repeat offenders 13 STR’s TPOX D3S1358 TH01 D8S1179 D5S818 VWA FGA D7S820 CSF1PO AMEL D13S317 AMEL D16S539 D18S51 D21S11