DNA Gene A Transcriptional Control Imprinting Histone Acetylation # of copies of RNA? Post Transcriptional Processing mRNA Stability Translational Control Post Translational Control Protein stability # of copies of protein? Function of protein?

Problem - With Most Molecular Techniques Can Only Work with ONE RNA at a Time -RT-PCR -Northern Blots -Nuclease Protection Some Techniques which look at more than one RNA at a Time -Subtractive Hybridization -Differential Display Problem: Still need to isolate the genes and figure out what you have after you find changes in gene expression

Overview of Microarray Technology First Step: The Genome Projects - Finding out the Sequences Of all sorts of cDNAs and processing them. Second Step: Print Array of cDNAs, ESTs, Oligos On Glass Slides - 2 cm x 2 cm - 6,400+ genes/square!!!!!

An Overview of Array Technology

- DNA from the Frontal Cortex From Alcoholics (Green) -DNA from the Frontal Cortex of Non-Alcoholics - control (Red) Step 6: Analysis by Computer

- 4% of 4,000 RNAs Tested Were Different Between Alcoholics And Non-Alcoholics by 40% or More

Two Methods of Printing Arrays 1. Spotting 1 kB cDNA amplified by PCR Spotted onto coated glass slide

#2 -- Direct Oligonucleotide Addition - Uses Chemical Blocking T TTGGTTGG GATATACGTCTTGGCGATATACGTCTTGGC 1. Tens of thousands of the same oligonucleotide are made within a small square Area 2. Oligonucleotides range in size from 8 to 70 nucleotides

Hybridization Must be Controlled - Data Must Be Repeated -False Hybridization -Probes May Not Bind Correctly ( a lot of controls need to be Done) Disadvantage - Only Relative Amounts of Activity Can Be Seen. Go Back To Northern - RT- PCR… to See Actual Changes.

-Malaria -- Parasitic Expressions - study changes that happen in parasite Over the Course of Disease Examples of Micro Array Analysis - Brain Disease/Neurodegenerative Disease -Cancer -Yeast Studies - First Microarray Studies in Yeast -To Study Changes Between Aerobic and Anarobic Bacteria - Development - Studies Ongoing in Many Organisms including Arabidopsis, Drosophila, Yeast, and Rat - SNP analysis to detect changes in cancer causing genes, HIV protein

What’s NEXT - PROTEIN MICROARRAYS - already Developed although less widely used than DNA Arrays - Spot Protein onto array - Protein- Protein Interactions - Enzyme-Substrate Interactions (used to detect kinases) - Small Molecule Protein Interactions (receptor binding) glutamate to receptor... -Protein - Antibody Interactions Howard Hughes Medical Institute investigator Stuart L. Schreiber and Gavin MacBeath