- TARGETED ANALYSIS - Proteomics Unit. Centro Nacional de Biotecnología sHPP Adán Alpízar Morúa.

Slides:

Advertisements

Similar presentations

- DATA DEPENDENT ANALYSIS - Proteomics Unit. Centro Nacional de Biotecnología sHPP Miguel Marcilla Goldaracena.

Advertisements

Mechanism of hormone action

Methanol/Chloroform precipitation In-solution digestion Off-line HPLC-RP Basic pH Methanol/Chloroform precipitation In-solution digestion Off-line.

Thursday 9/ Mike Mueckler

Lesson 3: Translation.

Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.

Post-Translational Events I Translocation of Newly Synthesized Proteins into Membranous Organelles.

PEPTIDE SYNTHESIS in targeted proteomics Proteomics Facility – National Centre of Biotechnology SpHPP Manuel Lombardía Uría.

Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.

ATP Powered Pumps By Adam Attebery.

Ion Channels. Cell membrane Voltage-gated Ion Channels voltage-gated because they open and close depending on the electrical potential across the membrane.

Nobel Prize in Physiology or Medicine For “the structure and functional organization of the cell” Christian de Duve George E. Palade Albert Claude.

Colinearity of Gene and Protein DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription translation.

The Secretory Pathway - Classic Experiments - ER Translocation - Membrane budding and fusion.

RIBOSOMES & ENDOPLASMIC RETICULUM.. Ribosomes  Made of ribosomal RNA and protein  Synthesized by nucleolus of cell  Proteins from cytoplasm are brought.

Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.

Regulation of Blood Glucose Level

Unfected > Infected AnnotationAccession numberGOName and other namesRDiscussed CDC45-related proteinCU apoptosis/cell cycle Cdc45l, Cdc451.11x Centrosomal.

CGMP Intracellular Signal cGMP is made from GTP by the enzyme gaunylyl cyclase. Atrial natriuretic peptide and nitric oxide function through this Signal.

Uninfected < Infected AnnotationAccession numberGOName and other namesRDiscussed Baculoviral IAP repeat-containing protein 7CU apoptosis/cell cycle.

Factors that might affect the Allotopic Replacement of a Damaged Mitochondrial DNA-encoded Protein S.J. Zullo J.M. Eisenstadt, C.R. Merril, H. Weiner.

Endo 3: Genes and enzymes: hormone synthesis Synthesis of protein and peptide hormones by gene transcription Post transcriptional and post translational.

Hydroxymethylglutaryl-coenzyme A (HMG-CoA) is the precursor for cholesterol synthesis. HMG-CoA is also an intermediate on the pathway for synthesis of.

Part V Second Messengers. The first messengers being the extracellular signal molecules and the third messengers being the large protein kinases and phosphatases.

Figure S1 and Table S1 Exposure of human monocytes to oxLDL leads to rapid changes in proteins phosphorylation status Human monocytes treated for 5,15.

Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.

1 Table S1. Human peptide sequences with homology to E *. Protein NameSequenceGene exocyst complex component 2TIQDLILDLREXOC2 BAG family molecular.

OXIDATIVE PHOSPHORYLATION. Oxidative Phosphorylation  The process in which ATP is formed as a result of the transfer of electrons from NADH or FADH 2.

University of Jordan1 Receptors Functions and Signal Transduction- L3 Faisal I. Mohammed, MD, PhD.

MiRNAPredicted targetsPutative function of targets miRC1GRMZM2G029833_T01DNA binding / DNA-directed RNA polymerase miRC4 GRMZM2G171796_T01; GRMZM2G355906_T03;

Assist prof. of Medical Physiology. To do its action, the hormone must bind to specific molecules on the cells called receptors.

FIRST APPROACH TO THE SHOTGUN UNKNOWN PROTEINS sHPP CHROMOSOME 16 MEETING August, 28, 2012 La Cristalera, Miraflores de la Sierra.

Chapter 15 Cellular Signal Transduction The biochemistry and molecular biology department of CMU.

O60831 – PRA1 family protein 2 (SILAC assay) ° - H 2 O loss; * - NH 3 loss.

Ribosomes & Endoplastic Reticulum. Ribosomes Organelles that make protein Found in cytoplasm or bound to E.R. Made of two subunits: Nucleic acids and.

P41273 – Tumor necrosis factor ligand superfamily member 9 (Reverse assay) ° - H 2 O loss; * - NH 3 loss.

CCAGTTGCCGCGTTCACCCTCTCCTCATCCGCGGTTCACCGGCCTCGTTGAGACTGCCTG  SCO0033 GGCCGTCATTCCGACAGCACCCACGTCTCACTCCCCGTGCCCATGCGGGGACCGGGCGGC CCGGCAGTAAGGCTGTCGTGGGTGCAGAGTGAGGGGCACGGGTACGCCCCTGGCCCGCCG.

Supplementary table 2. Genes upregulated in both microarray and RNA-seq analysis Gene IDGene SymbolGenBank accesion no.Microarray FCP.ValueRNA-seq FCTM/SP.

LacZ L, cells infected with ade-LacZ grow in HBSS buffer with 3mM glucose LacZ H, cells infected with ade-LacZ grow in HBSS buffer with 15mM glucose Del.

The Signal Hypothesis and the Targeting of Nascent Polypeptides to the Secretory Pathway Tuesday 9/ Mike Mueckler

Proposal Abstract/Specific Aims (1 page) Background (4-6 pages) Research Plan (8-10 pages) References.

Next theme: ion channel modulation (or “indirect” synaptic transmission) 1.

E NDOMEMBRANOUS S YSTEMS By; Ayesha Shaukat. Functions of Rough ER  Many types of cells secrete proteins produced by ribosomes attached to rough ER.

Ubiquinol (QH2) is also the Entry Point for Electrons From FADH2 of Flavoproteins succinate dehydrogenase (integral membrane protein of inner mitochondrial.

Intracellular Ca2+ signalling

Protein Synthesis and Sorting: A Molecular View

The Nobel Prize in Physiology or Medicine 1999

Schematic working model of the hepatic microsomal glucose-6-phosphatase system. ER = endoplasmic reticulum. This model is not meant to represent the actual.

Cytosol Nucleus Mitochondria Secreted ER Golgi Endosome Lysosome Transmembrane.

Cell Membrane Structure

Carbon atoms have unique bonding properties.

Adil E. Bharucha, Scott A. Waldman Gastroenterology

Human Anatomy & Physiology

Growth Hormone Receptor

Insulin and Glucagon Kamilah Gonzalez.

Secretin and vasoactive intestinal peptide receptors: Members of a unique family of G protein–coupled receptors Charles D. Ulrich, Martin Holtmann‡,

Supplementary Table 2. List of downregulated genes by PAUF **

in the Gene’s Polypeptide Product

Mechanism of hormone action

Let's look at cysts from both sides now

Importing Mitochondrial Proteins: Machineries and Mechanisms

Volume 89, Issue 4, Pages (May 1997)

The Ubiquitin Proteasome System in Neurodegenerative Diseases

Kim Fisher, PhD, Terence J Coderre, PhD, Neil A Hagen, MD, FRCPC

Vms1 Relieves a Mitochondrial Import Chokehold

Volume 57, Issue 3, Pages (March 2000)

HOW DO LIPID SOLUBLE HORMONES WORK???

Molecular biology of distal nephron sodium transport mechanisms

Why Have Organelles Retained Genomes?

Presentation transcript:

- TARGETED ANALYSIS - Proteomics Unit. Centro Nacional de Biotecnología sHPP Adán Alpízar Morúa

KnownUnknown ProteinAccession numberNameProteinAccession numberName P02795MT2_HUMANMetallothionein-2Q96M29TEKT5_HUMANTektin-5 Q58EX7PKHG4_HUMANPuratrophin-1Q96MC5CP045_HUMANUncharacterized protein C16orf45 Q01726MSHR_HUMAN Melanocyte-stimulating hormone receptor Q14028CNGB1_HUMAN Cyclic nucleotide-gated cation channel beta-1 Q14764MVP_HUMANMajor vault proteinP23975SC6A2_HUMAN Sodium-dependent noradrenaline transporter Q0VD83APOBR_HUMANApolipoprotein B receptorQ8NC67NETO2_HUMANNeuropilin and tolloid-like protein 2 Q6EMK4VASN_HUMANVasorinQ8IZ96CKLF1_HUMAN CKLF-like MARVEL transmembrane domain- containing protein 1 O14983AT2A1_HUMAN Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 P33527MRP1_HUMANMultidrug resistance-associated protein 1 P22695QCR2_HUMAN Cytochrome b-c1 complex subunit 2, mitochondrial P60510PP4C_HUMAN Serine/threonine-protein phosphatase 4 catalytic subunit P55287CAD11_HUMANCadherin-11 Q49A26GLYR1_HUMANPutative oxidoreductase GLYR1 Q4KMP7TB10B_HUMANTBC1 domain family member 10B Q14019COTL1_HUMANCoactosin-like protein Q9NXV2KCTD5_HUMAN BTB/POZ domain-containing protein KCTD5 Q9Y221NIP7_HUMAN 60S ribosome subunit biogenesis protein NIP7 homolog P55259GP2_HUMAN Pancreatic secretory granule membrane major glycoprotein GP2 O75150BRE1B_HUMANE3 ubiquitin-protein ligase BRE1B Q2VPK5CTU2_HUMANCytoplasmic tRNA 2-thiolation protein 2 Q8N9N5BANP_HUMANProtein BANP Assigned Proteins

KnownUnknown ProteinAccession numberNameProteinAccession numberName P02795MT2_HUMANMetallothionein-2Q96M29TEKT5_HUMANTektin-5 Q58EX7PKHG4_HUMANPuratrophin-1Q96MC5CP045_HUMANUncharacterized protein C16orf45 Q01726MSHR_HUMAN Melanocyte-stimulating hormone receptor Q14028CNGB1_HUMAN Cyclic nucleotide-gated cation channel beta-1 Q14764MVP_HUMANMajor vault proteinP23975SC6A2_HUMAN Sodium-dependent noradrenaline transporter Q0VD83APOBR_HUMANApolipoprotein B receptorQ8NC67NETO2_HUMANNeuropilin and tolloid-like protein 2 Q6EMK4VASN_HUMANVasorinQ8IZ96CKLF1_HUMAN CKLF-like MARVEL transmembrane domain- containing protein 1 O14983AT2A1_HUMAN Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 P33527MRP1_HUMANMultidrug resistance-associated protein 1 P22695QCR2_HUMAN Cytochrome b-c1 complex subunit 2, mitochondrial P60510PP4C_HUMAN Serine/threonine-protein phosphatase 4 catalytic subunit P55287CAD11_HUMANCadherin-11 Q49A26GLYR1_HUMANPutative oxidoreductase GLYR1 Q4KMP7TB10B_HUMANTBC1 domain family member 10B Q14019COTL1_HUMANCoactosin-like protein Q9NXV2KCTD5_HUMAN BTB/POZ domain-containing protein KCTD5 Q9Y221NIP7_HUMAN 60S ribosome subunit biogenesis protein NIP7 homolog P55259GP2_HUMAN Pancreatic secretory granule membrane major glycoprotein GP2 O75150BRE1B_HUMANE3 ubiquitin-protein ligase BRE1B Q2VPK5CTU2_HUMANCytoplasmic tRNA 2-thiolation protein 2 Q8N9N5BANP_HUMANProtein BANP Methods (MRM Pilot) 1

AEAESR 331.7/ / / /401.2

GPLEYPSAK 530.8/ / / /906.5

MCF7 (SDS/PAGE Band 8) P / / / EILVEESNVQR (+2)QITQVYGFYDECLR (+2) QITQVYGFYDECLRK (+3) 896.4/ / / / / /1187.5

Selection Criteria of the Synthetic Peptides Peptide Synthesis peptides per protein Unique peptides Peptide Length: 9-21 residues No missed cleavages No M and W No Q by N-ter MRM atlas

Peptide Synthesis 3

Peptide Synthesis (MRM) 3

Currently, data depedent analysis yields better results in terms of sensitivity and number of identifications than MRM We have not yet implemented a robust workflow for the routine implementation of MRM methods We have implemented a platform that allows the simultaneous synthesis of a significant (≈ 60) number of peptides Conclusions

acknowledgments Fernando Roncal Manuel Lombardía Miguel Marcilla Severine Gharbi Carmen González Rosana Navajas Alberto Paradela Salvador Martínez Alberto Medina