Measuring Genetic Variation in Natural Populations Historical Method: Examining protein variation via electrophoresis Modern Method: DNA sequencing and typing

More than one allele at 30-50% of all loci in a population. Such loci are called polymorphic. LDH-B cline in Fundulus

Most populations harbor considerable genetic diversity Heterozygosity

Heterozygosity has a couple of interpretations: 1)Average percentage of loci that are heterozygous per individual. or 2)Average percentage of individuals that are heterozygous per loci.

DNA Sequencing : How is it done? Heat : Single strands separate Primer Anneals Only use one primer DNA polymerase All possible DNA fragments are synthesized ATGCTAACGCCATTCGA T TATA TAC TACG TACGA TACGAT 2 kinds of nucleotides (1) Regular Nucleotides (2) Fluorescent (ACGT) terminating nucleotides Double Stranded DNA ATGCTAACGCCATTCGA TACGATTGCGGTAAGCT

Laser TACGAT TACGA TACG TAC TATA T (-) Cathode (+) Anode Gel Electrophoresis Synthesized DNA T AC Computer Interprets Fluorescent Code

TTCTTCAGGGGAGGGGGTGGAANATAAAAACAAAAACCCTACAATGTATATTCATCGCCCATAATCGGCTACTTAGACA Electropherogram DNA Sequence Data From Automated Sequencer

Another Way to Isolate Genes : Polymerase Chain Reaction (PCR) HeatSingle Strands Separate Heat Double Stranded DNA Heat Resistant DNA Polymerase makes new strands Primers Anneal Primers Anneal Two DNA fragments are produced

PCR 123 Cycles 4 Copies etc DNA is Amplified

Anode (+) Cathode (-) An Agarose Gel DNA Base Pairs

(75 x 2) + (24) / (102 x 2) = / /2 (24/102) = 85.3 Counting alleles or Genotypic frequencies

Sequencing Studies Have Revealed Enormous Genetic Diversity CFTR Locus

Population Genetics Evolution depends upon mutation to create new alleles. Evolution occurs as a result of population level changes in allele frequencies. What evolutionary forces alter allele frequencies?

How do allele frequencies change in a population from generation to generation?

Hardy-Weinberg Principle (1)Allele frequencies in a population will not change, generation after generation. (2)If allele frequencies are given by p and q, the genotype frequencies will be given by p 2, 2pq, and q 2. When none of the evolutionary forces (selection, mutation, drift, migration, non-random mating) are operative:

Allele frequencies in the gene pool: A: 12 / 20 = 0.6 a: 8 / 20 = 0.4 Alleles Combine to Yield Genotypic Frequencies

Our mice grow-up and generate gametes for next generations gene pool

Allele frequency across generations: A General Single Locus, 2 Allele Model Freq A 1 = p Freq A 2 = q

One locus, 2 Allele Model GenotypeA 1 A 1 A 1 A 2 A 2 A 2 Frequency of allele A 1 = p Frequency of allele A 2 = 1 - p = q In a diploid organism, there are two alleles for each locus. Therefore there are three possible genotypes: Given: Then: GenotypeA 1 A 1 A 1 A 2 A 2 A 2 Frequencyp 2 2pqq 2 A population that maintains such frequencies is said to be at Hardy-Weinberg Equilibrium

Hardy-Weinberg Principle (1)Allele frequencies in a population will not change, generation after generation. (2)If allele frequencies are given by p and q, the genotype frequencies will be given by p 2, 2pq, and q 2 When none of the evolutionary forces (selection, mutation, drift, migration, non-random mating) are operative:

Hardy-Weinberg Principle Depends Upon the Following Assumptions 1.There is no selection 2.There is no mutation 3.There is no migration 4.There are no chance events 5.Individuals choose their mates at random