Sequences and their Properties

Nucleotides  DNA  A, T, G, C  RNA  A, U, G, C

Writing sequences  Written 5’-3’  ATGGGTAGCGGTCATGATAC  Complement  TACCCATCGCCAGTACTATG  Reverse (inverse)  CATAGTACTGGCGATGGGTA  Reverse complement  GTATCATGACCGCTACCCAT

Annealing  Nucleic acids can base pair with their reverse complement sequence  Two opposing forces affect annealing  Hydrogen bonds favours annealing  Phosphate groups favours denaturation

Annealing-Melting Point (Tm)  The Tm is the temperature at which 50% of the nucleic acid molecules are in a single stranded state (or double stranded)  The Tm is a function of:  Percentage G:C  Ionic composition of the environment  The percentage of complementarity  Estimate of Tm  =2(#A:T) + 4(#G:C) 5

6 Tm Vs percentage G:C % Double stranded Temperature (C) (38%) G+C (52%) (58%) (66%)

7 Tm Vs Conc. of Positive Ions % Double stranded Temperature (C) (0.1M NaCl) (0.2M NaCl) (0.5M NaCl)

8 Tm Vs percentage of Complementarity % Double stranded Temperature (C) (25%) (50%) (100%)

Stringency  Percentage of complementarity required to allow the formation of stable duplexes  The Tm influences the stringency conditions required to allow annealing  A high stringency requires a high level of complementarity   GATCCGGTTATTA vs GATCCGGTTATTA CTAGGCCAATAAT CTTGGACGATAAT 9

Parameters that Influence Stringency   [salt] = High stringency   Temperature = High stringency   [salt] = ?   Temperature = ? 10

11 Method: Transfer and Immobilization onto Solid Support Filter paper - wick Gel Well Membrane Filter paper Absorbant paper Weight 20X SSC Solution– 3M NaCl, 0.3M NaCit.

12 4. Hybridization with Free Probe Wash

13 Detection: Autoradiography

14 Properties of the Probe  Complementarity  Complete or partial? Complete; ideal; 100% complementarity Partial continuous; acceptable 100% complementarity Partial discontinuous; more difficut Partial complementarity

15 Hybridization Stringency

The Probe  Labelled DNA or RNA molecule  Single stranded  Strand specific (sense specific)  Double stranded  Strand non-specific (sense non specific)

 Indiret detection Digoxygenin Labelled Probe SSSS Membrane Target DDDDDDDD Probe+ Dig ENZ Ab-Dig conjugated Peroxidase X ray film

Hybridization Signals  Hybridization  Specific  Non specific  Background  Binding of probe to membrane  Binding of Ab to membrane

Decoding the Genetic Information  Information encoded in nucleotide sequences is contained in discrete units  The genes  The information contained in the genes is transcribed to generate the RNAs and then decoded (translated) to generate the proteins

Protein Coding Sequences  Protein containing sequences contain ORFs  Start – ATG  Stop – TAG, TGA, TAA

Transcription - Translation Transcription: RNA pol Translation: Ribosomes NH 3 -M-T-R-S-W-G-L-I-S-I-COOH

ORFs  All double stranded sequences necessarily have 6 reading frames How many ORFs does this sequence have? ATGCCGATTAGA> TGCCGATTAGAG> GCCGATTAGAGA> <CTGTCGGTAATT <TCTGTCGGTAAT <CTCTGTCGGTAA 5’-ATGGCGATTAGAGACAGCCATTAA-3’ 3’-TACTGCTAATCTCTGTCGGTAATT-5’

Homologues  Gene sequences that possess a common ancestor  Homologues share a high level of identity  Identity  Percentage of bases or amino acids that are the same between different sequences 23

Nucleotide Homologues 24 77% identity  DNA sequences with greater 70% identity  Ex. A homologue of the human hemoglobin gene is found in soya G.G.T.G.A.G.G.G.T.A.T.C.A.T.C.C.C.A.T.C.T.G G.G.T.C.A.G.G.A.T.A.T.G.A.T.T.C.C.A.T.C.A.C * * * * * * * *

Protein homologues  Protein sequences with greater than 25% identity  Ex. A protein homologue of the human hemoglobi is found in soya 25 Percentage identity: 28% G A R G G W L G.G.T.G.A.G.G.G.C.A.T.C.A.T.C.C.C.A.T.C.T G.G.T.C.A.G.G.A.C.A.T.G.A.T.T.C.C.A.T.C.A G T P M I W E

Homologues  Orthologues :  Homologues found in different organisms which have a common ancestor  Duplication followed by speciation  Paralogues :  Homologues found within the same species  Duplication prior to speciation 26

Mutations

Types of Missense Point Mutations  Neutral Synonymous/Silent :  Base change that does NOT change the amino acid coded  Ex. AGG → CGG both Arg  Non-Synonymous - Conserved:  Base change results in a different but similar amino acid  Same charge and shape  Ex. AAA → AGA Lys to Arg both basic amino acids

Types of Missense Point Mutations  Non-Synonymous-Semi conserved:  Base change resulting in a different but similar amino acid  Same shape but different charge  Ex. CGC → CUC Arg (Polar) to Leu (Non-polar)  Non-Synonymous - Non conserved  Base change resulting in totally different amino acids  Different shape different charge