Mystery of the Matching Marks

DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS …

How are these marks used to solve crimes?

RIGHT! They are used to COMPARE bullets found at a crime scene, with bullets that were fired from suspect guns

Here are the marks from a crime scene bullet…

and here are the marks from bullets fired from four possible suspect guns… AB CD

Which bullet matches the crime scene bullet? A Crime Scene:

B Which bullet matches the crime scene bullet?

C Crime Scene: Which bullet matches the crime scene bullet?

D Crime Scene: Which bullet matches the crime scene bullet?

RIGHT! It’s a bullet shot from gun C. So what does that tell us? C Crime Scene:

YOU’VE GOT IT! The Crime Scene bullet and bullet C came from the SAME GUN ! C Crime Scene: We could say the bullets had a “Common Origin”

Many studies have told us that when any two items with COMPLEX PATTERNS MATCH EACH OTHER perfectly, we can be confident that they had a… COMMON ORIGIN !

KEEP THIS IN MIND: When we find other COMPLEX PATTERNS that MATCH, What does this tell us? They had a… “COMMON ORIGIN” This is our theme: Matching Complex Patterns = COMMON ORIGIN

What is this?

Right, it’s a HUMAN KARYOTYPE

A Human Karyotype has photos of all the matched pairs of human chromosomes from one cell, stained to show banding patterns, and arranged from long to short, with centromeres near the top. Here are our numbers 6-9…

On the next slide, you will see another kind of human karyotype: It has diagrams of the chromosomes, with only one member of each pair, clearly showing their banding patterns…

And on the next slide, you will see a similar diagrammatic karyotype, but this is from a NON-HUMAN SPECIES…

NEXT, we wll see both karyotypes together, showing the matching chromosomes side by side: each human chromosome is on the left… each NON-human chromosome is on the right As you COMPARE the CHROMOSOMES, side-by-side, what is MOST surprising?

What is most surprising?

Did you notice how very SIMILAR they are? Here’s a closer look at the first seven: Any identical ones? What did we say about items with IDENTICAL COMPLEX PATTERNS?

RIGHT! Identical Patterns = COMMON ORIGIN How would this apply to two different SPECIES with IDENTICAL banding patterns on their CHROMOSOMES? RIGHT! They MUST have a Common Origin, or a COMMON ANCESTOR !

Time for a Revelation… The clear chromosome evidence of identical banding patterns tells us that humans and chimpanzees must have had a… The non-human species is the CHIMPANZEE

Somewhere, in our distant past, there was an ape-like species that gave rise to two lines of ancestry. One branch led to modern CHIMPS, the other branch led to HUMANS. COMMON ANCESTOR ! DNA analysis and fossils tell us that this split was around 6-7 million years ago (6-7 mya ) <--- Common Ancestor Chimps Us 6 mya NOW

That’s pretty strong stuff... Is there any other evidence that supports this conclusion? Let’s take another look at those chromosomes…

Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT from the human chromosomes (on the left)?

How are they different?

GOOD EYES! - Chimp’s #2 is shorter than our #2 -Chimp has an extra unmatched chromosome What could have happened to cause those differences? Let’s take a closer look at those chromosomes…

ANY IDEAS that might EXPLAIN the “missing” part of the chimp’s #2 chromosome, AND the chimp’s “extra” chromosome? “Missing” part“Extra” in chimps

Maybe the chimp’s “extra” chromosome was once part of its short #2. Could the “extra” chromosome match the upper part of our #2? LET’S TRY IT…

Nope! They don’t seem to match. What else could we try? Turn the “extra” one upside down?! Let’s try it…

WOW ! IT WORKED! They DO MATCH! NOW, the next question: “How could this happen?” - Was there ONE #2 in our common ancestor, that split to make TWO in chimps, OR - Were there TWO short chromosomes in our ancestor that fused (joined) to make ONE?

We DO have a PROBLEM: “How did this difference happen?” 1. One split to make two, OR And, we have two hypotheses (possible explanations): Let’s try the second one (fusion). How can we TEST that hypothesis? 2. Two fused (joined) to make one

We could look for evidence of fusion in the middle of our #2 chromosome… But, what kind of evidence can we look for? Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…

Head Telomer e Centromere Tail Telomere CHROMOSOME PARTS ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc… All Chromosomes have telomeres at both ends (like shoelace aglets!) Telomeres have a special DNA sequence…

DNA Sequence for Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Head Telomer e Centromere Tail Telomere NOTICE: Tandem Repeats in Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Did you notice the repeated sequence: ttaggg? “ttaggg” is repeated times in each Telomere

Here’s another view of a chromosome, showing the telomeres untwisted, and their typical DNA sequence It also shows that the upper (shorter) arm above the centromere is called the “p-arm”, and the lower (longer) arm is called the “q-arm”

Here are ends of the upper telomeres of the chimp’s “short” chromosome (left)… Short #2“Extra” and its “extra” chromosome (right) TELOMERE DNA CLOSE-UP

When we turn the “extra” chromosome upside-down, and try to connect it to the “short” chromosome, it only FITS one way (left)… They do NOT fit when one telomere is twisted 180 o (right) NOTICE!

FURTHERMORE… When we lay the fusion area on its side, we can see more clearly how the DNA sequence changes at the fusion point. Reading the top strand only, see: T T A G G G C C C T A A

THAT’S WHAT YOU WILL BE LOOKING FOR When you are searching the DNA for the Fusion Point, you will be looking at only one strand of DNA (since the “lower” strand is the predictable complement of the “upper” strand). Look for something like this: …ttagggttagggttagggccctaaccctaaccctaa… Read this like lines of text in a book… Do you see where the multiple g’s (and no c’s) END, and multiple c’s (and no g’s) BEGIN?

What would this point be called? (where multiple g’s stop, and multiple c’s begin) This would be the FUSION POINT Raise your hand when you see that point in this actual DNA strand below: On which line does the change happen?

Maybe this will show it more clearly: GOT THE PICTURE? THERE’S the FUSION POINT !

NOW… WHERE should we LOOK for the FUSION POINT? YES! Right in the MIDDLE of our chromosome #2, where the two matching chimp chromosomes overlap ! 2a 2b

This would be BELOW the CENTROMERE, in the “q-arm” of the chromosome, in the region known as “2q13”, shown in red. (Can you figure out where the number “2q13” comes from?) 2b 2a

(OPTIONAL) For “2q13”… 2 = chromosome #2 q = the q-arm 1 = region 1 of that arm 3 = sub-part 3 of that region 2b 2a

I have gone to an online DNA database and printed out the DNA in that region. You could do this yourself, but, to save time, I’ve done that for you… So, where can we see the DNA from this region of our #2 chromosome to examine?

This 2q13 region gives us 52 pages of DNA! This is what a page looks like… On this page, there are 57 lines, each line with 60 bases (letters), and that gives us… 3,420 bases per page!

If these 52 pages were attached end-to-end, they would stretch about 14 meters (16 yards) around your room! AND… If ALL the DNA from our ENTIRE #2 chromosome was printed out like this, it would stretch about 16 km (10 miles)!

By the way… Each number on the left edge equals the number of the first base (letter) on that line. And, a space has been inserted after every 10th base (letter) to make counting easier.

You may notice when you are searching, that the “ttaggg” pattern is not perfect! An occasional “c” slips in here and there, and you will see other minor “glitches.” WHY? If you said “MUTATIONS,” you would be right.

NOW, it’s YOUR turn! You get to SEARCH those 52 pages! Are you ready??? Just kidding! Observe the following slide (one of the 52 pages) and see if you can find the fusion point

agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg Can you see the telomeres?

RESULTS CLARIFIED: agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg Head Telomere of “extra” chrom. 2a Head Telomere of “short” chrom. 2b FUSION POINT !

taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta Did you know… you’ve got FOSSILS in YOU ! All of you have these fossils, in the #2 chromosome of every cell ! Fossils are the remains of ancient life, and these are the telomeres of two chromosomes from your ancient ancestor ! So, these telomeres are your very own MOLECULAR FOSSILS ! Telo. 2a Telo. 2b

PREDICTIONS: If our hypothesis was true, we should find two telomeres there; If NOT true, should be NO telomeres there. Did we find telomeres there? YES! Therefore… Our hypothesis was supported: Our #2 chromosome WAS formed from the FUSION of two chromosmes in an ancient ancestor after the chimpanzees branched off. CONCLUSION

A Peek at the Chromosomes of Other Apes… On the next slide, you will see the chromosome diagrams for humans, chimpanzees, gorillas, and orangutans, all the :”Great Apes” They are shown side by side for easy comparison…

The Chromosomes of Humans and Apes Compared For each number, the chromosomes are arranged in this order (left to right): human, chimpanzee, gorilla, orangutan What is most striking?

RIGHT! They are ALL Strikingly Similar! And what do we know when we find identical or very similar patterns on different items? RIGHT! They had to have a COMMON ORIGIN Or, in this case… COMMON ANCESTRY

Based on these chromosome comparisons… Biologists have been able to draw a phylogenetic tree, showing how primates are related to each other. The following slide shows the tree (called a “Primate Cladogram”). See if you can point to where the COMMON ANCESTORS of Modern Primates would be LOCATED on the tree…

Did you find ALL of the Common Ancestors?

Did you notice… All the other apes had that “extra” chromosome, too? This confirms that this is the more PRIMITIVE (original) CONDITION, so our SINGLE #2 chromosome is the DERIVED CONDITION (the result of fusion)

When we compare primates by using other features, including DNA, different proteins, anatomy, physiology, and fossils, Biologists have developed similar Cladograms (Phylogenetic Trees), like these… MORE CONFIRMING EVIDENCE

See how similar they are? Based on Albumin Protein Analysis: Based on DNA Hybridization Analysis

And here’s another one… Again… basically the same pattern

When all the data point to essentially the same conclusions, this strengthens those conclusions. Biologically, humans are very closely related to the apes. In fact, chimps are closer to US, than they are to gorillas! Humans and chimps are even closer than zebras are to horses! Biologists have even recommended that humans and chimps be in the same genus!

LESSON WRAP-UP REALITY-CHECK QUESTIONS MORE DNA SEARCHES

Time for a REALITY CHECK Number your paper from 1-8 Based on the observed data… Which are true… which are false? 1. All chromosomes have telomeres at both ends. 2. All chromosomes have telomeres in their middles. 3. Identical complex patterns on different items means they had a common origin. 4. A hypothesis is a prediction.

REALITY CHECK cont. Which are true… which are false? 5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor. 6. Humans evolved from monkeys. 7. Humans evolved from chimpanzees. 8. Humans & chimpanzees evolved from a common ancestor.

DID YOU ENJOY THE SEARCH? Here are some more DNA searches Go online to search a DNA database - See “Chromosome Fusion” for directions (get internet address from teacher) Look for the “Lost Centromere” - Did you notice that the centromere in the “shorter” (lower) chimp chromosome disappeared? Is there any DNA evidence for a centromere still THERE in our #2 chromosome? Look for telomere DNA on the ends of different chromosomes, different organisms.

END OF LESSON ADDENDUM FOLLOWS More Models of Telomere DNA More Evidence Telomere Tid-Bits

ADDENDUM More Evidence Telomere Tid-Bits Key to “Reality Check” Extensions: DNA Searching

Confirmation: More Evidence When we compare ALL the DNA in our #2 chromosome with ALL the DNA in the two chimp chromosomes… we find that it is all the same DNA !

However… When we compare ALL the DNA in our #2 chromosome with DNA in Dog chromosomes… we find that our #2 is a patchwork of DNA from 8 different Dog chromosomes! (WHY?)

If you said “More time since we branched from our COMMON ANCESTOR with dogs, SO, more time for more chromosome changes and other mutations,” YOU GOT IT! WHY?

Telomere Tid-Bits Telomeres apparently protect the ends of our chromosomes, keeping the gene-DNA from getting damaged. Each time our chromosomes replicate and cells divide, a little of each telomere is lost, so they get shorter as we age! This is one reason why embryonic stem cells are preferred over adult stem cells in stem cell research.

More Telomere Tid-Bits There is an enzyme, telomerase, that can replace some of the missing telomere DNA. It’s thought that defective telomerase could be a cause of aging problems. Telomeres and telomerase are the subjects of much research into cancer, heart disease, brain function, and other problems of aging.

KEY TO REALITY CHECK 1. All chromosomes have telomeres at both ends. True 2. All chromosomes have telomeres in their middles. False 3. Identical complex patterns on different items means they had a common origin. True 4. A hypothesis is a prediction. False

KEY TO REALITY CHECK (cont.) 5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor. True 6. Humans evolved from monkeys. False 7. Humans evolved from chimpanzees. False 8. Humans & chimpanzees evolved from a common ancestor. TRUE!

EXTENSIONS: DNA SEARCHING For DNA in the 2q13 region online at NCBI, go to: Scroll down about 1/3 scroll bar distance to ORIGIN of segment. Then about 2/3 scroll bar down, to line for fusion area. To explore ENTIRE chromosome #2, or to see DNA in other chromosomes or chromosomes of other animals, go to Click on the species (Homo sapiens 36 for our chromosomes), then click on the desired chromosome number. Click area of chromosome (or blue line contig) where you want to see the DNA (2q13 in the human chromosome #2 for the fusion area). For detailed directions, see “Chromosome Fusion” lesson:

EXTENSIONS: DNA SEARCHING IDEAS for SEARCHING: 1. Take a look at the DNA in the tip ends (telomeres) of any chromosome to see the characteristic tandem repeats of...ttaggg Look for the lower centromere area in chromosome #2 (where you should see the remains of the centromere that was in the shorter ancestral chromosome before it fused to the other short chromosome that makes up the p-arm of our #2 chromosome.) The old centromere region should be in the 2q21.2 region. 3. Using the BLAST search tool, see if you can find fusion areas in other chromosomes. For similar searches on another DATA BASE, try the ENSEMBL site at: