Secretion, Exocytosis & Endocytosis Lecture 22BSCI 420,421Oct 23,24, 2002 An old Cherokee told his grandson about a battle going on within him. “It is.

Slides:

Advertisements

Similar presentations

The Working Cell Figures 5.14 – 5.19

Advertisements

1 The Plasma Membrane The Plasma Membrane - Gateway to the Cell.

Cells: The Living Units: Part B.  Two types of active processes: ◦ Active transport ◦ Vesicular transport  Both use ATP to move solutes across a living.

Bulk Transport/Vessicular Traffic Bulk transport refers to the transport of solutes enclosed in vesicles. Many of these solutes are too large to diffuse.

A Closer Look at Cell Membranes Chapter 5 Part 2.

Last Class: 1. transportation at the plasma membrane A. carrier protein, B. channel protein 2. intracellular compartments A. nucleus, B. Endoplasmic Reticulum.

Endocytosis and Lysosome Formation The Endolytic Pathway.

Fluid Mosaic Model Figure 3.3. Functions of Membrane Proteins  Transport  Enzymatic activity  Receptors for signal transduction Figure

Lecture 11 Vesicular Trafficking: Lysosomes;

Vesicular Transport III. N-linked glycosylation because sugar is added to N of asparagine. original precursor oligosaccharide added to most proteins in.

Lecture 7 - Intracellular compartments and transport II

An Old Cherokee Tale of Two Wolves

Transport Mechanisms The four major categories of transport: filtration diffusion mediated transport vesicular transport.

Membranes Everything in life is variable –Chaotic Membranes organize the chaos of cellular metabolism –E.g. houses & stores with doors & gates –E.g. streets.

Structure and Function

2.4 Membranes Draw a diagram to show the fluid mosaic model of a biological membrane. (1) The diagram should show the phospholipid bilayer, cholesterol,

The Plasma Membrane – Gateway to the Cell

Lipoprotein Structures, Function and Metabolism (2)

Cholesterol Metabolism Southwestern Medical School Dallas, Texas.

Molecular and Cellular Biochemistry 2. ER- protein modifications

Chapter 2: The Endocrine System. 2.1 Systems of chemical mediation and communication.

Active Transport. Cellular energy is used to to transport substances across the membrane against a concentration gradient Energy is derived from splitting.

No energy is used [High]  [Low] (it’s the natural flow) This means it goes down a concentration gradient.

1 The Plasma Membrane The Plasma Membrane - Gateway to the Cell.

Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.

Integral Proteins Some transmembrane transport proteins are porins that form aqueous channels through membranes Some integral proteins anchored to the.

CYTOLOGY & HISTOLOGY Lecture Four

Vesicular Transport IV Chapter possible fates of receptor proteins in an epithelial cell.

MEDIATED TRANSPORT MECHANISMS By Dr. Ishtiaq Ali Dr. Ishtiaq Ali.

Receptor-Mediated Endocytosis As Presented By Michael Chan.

Active Transport. Moves molecules from low to high concentration AGAINST a concentration gradient Requires energy, so cell must use ATP.

Active Transport Joohee Kim Sec. III IB Biology. Active Transport  Active transport is the pumping of molecules against their concentration gradient.

Ch. 5- Membrane Structure and Function. Components of the Plasma Membrane  Phospholipid bilayer  Protein Molecules that are either partially or wholly.

Chapter 5 Membrane Structure & Function. Membrane structure, I Selective permeability Amphipathic polar & non-polar regions (ex. hydrophilic & hydrophobic)

This page is provided by the Beta Cell Biology Consortium - ( ) Beta Cell Biology Consortium prof. aza prof. aza.

Active Transport: Two Types

Endocytosis - Exocytosis

1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.

Active Transport.

A Closer Look at Cell Membranes  Aim: How do large particles enter and exit cells?  Do Now: Name some molecules/materials that enter and exit the cell.

TRANSPORT ACROSS CELL MEMBRANES Endocytosis and Exocytosis.

1. Name the three basic parts of a cell and describe the functions of each. 2. Why do phospholipids organize into a bilayer – tail-to-tail – in a watery.

A Closer Look at Cell Membranes Chapter 5 Part 2.

3.6 How Do Diffusion And Osmosis Affect Transport Across The Plasma Membrane? Simple diffusion through the phospholipid bilayer Fig. 3-7a Simple diffusion.

Vesicular Transport Pages The general flow of membrane enclosed material within cells.

Cell Membrane Part 2. 2 Carrier Proteins Other carrier proteins change shape to move materials across the cell membrane Other carrier proteins change.

Lecture 12: The secretory pathway

Biology Sylvia S. Mader Michael Windelspecht Chapter 5B Membrane Structure and Function Lecture Outline Copyright © The McGraw-Hill Companies, Inc. Permission.

1 The Plasma Membrane The Plasma Membrane - Gateway to the Cell copyright cmassengale.

Section 7-3 cont. Active Transport. Requires energy from the cell Requires energy from the cell Moves from low to high concentration Moves from low to.

Chapter 7: Membrane Structure & Function. membrane a fluid mosaic of lipids, proteins, and carbohydrates. held together by hydrophobic interactions membrane.

Active Transport Processes

The building blocks of life

Exocytosis, Endocytosis, Endosomes and Lysosome Formation

Lysosome Lect-7.

Conference on the Endocytosis

A Closer Look at Cell Membranes

Intracellular Compartments and Transport 2

Active Transport Sections 5.5 & 5.6.

Diffusion and Osmosis.

Warm-up Skimming is a method used to quickly identify the main ideas of a text. Read all headings Look at pictures and read the captions with them Look.

By: Waleedullah Jan BSc Human Biology

Active Transport Chapter 3, Section 3.

Moving across a membrane

3 Cells: The Living Units: Part B.

Cell Membrane Structure and Function

EXOCYTOSIS, ENDOCYTOSIS & RECEPTOR MEDIATED ENDOCYTOSIS

BOTH require energy from the cell

Chapter 13 Intracellular Vesicular Traffic.

Presentation transcript:

Secretion, Exocytosis & Endocytosis Lecture 22BSCI 420,421Oct 23,24, 2002 An old Cherokee told his grandson about a battle going on within him. “It is between two wolves, one is evil, full of anger, greed, envy, pride, and ego. The other is good, full of generosity, kindness, empathy, love, and humility.” “Which wolf wins?” said the grandson. The old Cherokee replied, “The one I feed.”

In addition to lysosomes, two secretory paths diverge from TGN

A.Constiutive pathway Continuous COP-1 coated ves from TGN No stimulus required for exocytosis Provides new plasma membrane proteins Continuously secreted proteins, e.g.: albumen from liver Igs from plasma cells Collagen from fibroblasts Default pathway that requires no additional signal

PM proteins can be targeted to 2 different domains, directly or indirectly

Lipid rafts are often transported to the cell surface as a group. Rich in cholesterol, long chain phospholipids & glycolipids, & Proteins w long TM domains.

B.Regulated secretion Specific receptors bind proteins and cluster into clathrin coated areas of the TGN. Proprotein cleaved to mature protein Ions pumped out and H20 follows to concentrate Stored in secretory granule until stimulus Transported by MTs upon stimulus Docking, Fusion, & exocytosis, often stim.by Ca2. E.g.s: protein hormones, inducers, cytokines, digestive enzymes

Formation of Secretory Vesicles and Maturation Maturation involves loss of clathrin coats, dehydration and concentration, and proteolysis. (pre-proinsulin -> proinsulin -> Insulin) Gold-labeled Anti-clathrin

Transport (MTs), docking, and fusion. Stimulated by receptor activation that increases Ca+2 in cells. Fig 57: Insulin secretion by exocytosis from pancreatic Beta cell.

In addition to 1) Exocytosis, three other types of secretion: 2) Apocrine secretion Release of a part of the cytoplasm, surrounded by pl. membrane. Egs: platelets from megakaryocytes, Milk fat globules from mammary gland cells 3) Holocrine secretion Release of complete cells into & out from a secretory duct Egs: Eccrine sweat gland cells- keep skin moist and oiled. Spermatozoa? 4) Monomolecular secretion Proteins secreted one molecule at a time w no membrane Egs: Bacterial secretion, yeast mating pheromones, and other ABC transporter secreted proteins

ENDOCYTOSIS – Uptake of macromolecules into cell in vesicles 1. Phagocytosis 2. Pinocytosis /Receptor-Mediated endocytosis Ingestion of large particles Activated by receptors on surface e.g. Fc rec for antibodies on WBCs like neutrophils: Fig 40 Triggers actin & myosin filament assembly & interaction to form pseudopods & engulf particles.

2. Pinocytosis /Receptor-Mediated endocytosis (RME) A.Formation of clathrin-coated pits RME was discovered by Brown & Goldstein by looking at skin Fibroblasts of children with Familial Hypercholesterolemia, a gene disease in which excess cholesterol causes early heart attacks. Mutant LDL receptors, so unable to take LDL out of bloodstream. LDL particle ApoB protein~1500 cholesterol esters

RME of LDL particles Can also be defective LDL binding Or defective targeting of receptor to the cell surface

Transcytosis- Eg newborn takes up antibodies from mother’s milk (Colostum)release at neutral pH Uptake at acid pH

Material from 3 different sources end up in lysosomes o