Chapter 8: From DNA to Protein Section 8.4 - Transcription

What do we know so far? DNA Proteins I get it!!! DNA is like DNA is the genetic information Located in Nucleus (protected in vault) Proteins all living things made of proteins Proteins made by ribosomes in cytoplasm proteins run living organisms example – enzymes So the DNA molecule is the instructions for making proteins!!! I get it!!! DNA is like a blueprint!!

But there is a problem………. Need to get the blueprint information (DNA message) from nucleus to cytoplasm We need mRNA!!!! We need a messenger

DNA RNA mRNA Who is the mRNA messenger? build proteins messenger RNA nucleus cytoplasm

The “Central Dogma” – information flows in one direction transcription DNA mRNA protein translation trait (phenotype) cell cytoplasm cell nucleus

You have to know differences between DNA and RNA for my test and EOC!!!! ribose sugar nitrogen bases G, C, A, U U = uracil U : A C : G single stranded DNA deoxyribose sugar nitrogen bases G, C, A, T T = thymine T : A C : G double stranded

Transcription is making mRNA from DNA Double stranded DNA unzips by helicase enzyme T G G T A C A G C T A G T C A T C G T A C C G T

Transcription is making mRNA from DNA Now that DNA is unzipped; enzyme RNA polymerase attaches base pairs T G G T A C A G C T A G T C A T C G T A C C G T

Transcription is making mRNA from DNA RNA polymerase will match RNA bases to DNA bases on one of the DNA strands Notice NO THYMINE!!!!!!! C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC Transcription is making mRNA from DNA U instead of T is matched to A in mRNA TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Once mRNA molecule is completed it leaves nucleus and goes to cell cytoplasm

Chapter 8: From DNA to Protein Section 8.5 - Translation

DNA instructions remain in nucleus and we have to send message out mRNA has the instructions for building proteins from DNA nucleus U C A G

Proteins are built as chains of amino acids aa Proteins are built as chains of amino acids What reads RNA? need a mRNA reader!

Now lets look at bigger picture!!! RNA to protein mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm amino acids are linked bc of mRNA message proteins built from sequence of amino acids Now lets look at bigger picture!!! mRNA A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa

RNA to protein bigger picture Cell cytoplasm aa transcription translation DNA mRNA protein ribosome mRNA leaves nucleus through nuclear pores U C A G proteins synthesized by ribosomes using instructions on mRNA trait Cell nucleus

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA think letters in alphabet ? protein How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codons ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein Ribosomes read mRNA in blocks of 3 nucleotides called a “Codon”

How are the codons matched to amino acids? DNA TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC mRNA UAC Met GCA Arg CAU Val tRNA anti-codon amino acid

The mRNA code Start codon Stop codons AUG UGA, UAA, UAG codon for methionine (Met) leucine (Leu) Strong evidence for a single origin in evolutionary theory.

Summarize whole process of “DNA to Proteins” aa transcription translation DNA mRNA protein ribosome tRNA aa U C A G trait Cell nucleus Cell cytoplasm

Different view of “DNA to Proteins” Cell cytoplasm transcription translation protein Cell nucleus trait

DNA transcription mRNA ribosome translation amino acids mRNA protein ribosome tRNA translation

Section 8.6: Gene Expression and Gene Regulation

The BIG Questions… How are our traits turned “on” or “off”?

How do cells control Gene Expression? Cells turn genes “on” & “off” by controlling transcription Remember what RNA Polymerase did?

How do cells control Gene Expression? For RNA Polymerase to do its job it has to attach to the DNA molecule Promoter - area of DNA where RNA polymerase binds. Also area where the “Gene” sequence begins. Operator – area of DNA that turns gene “on” or “off”. It’s the switch Lets take a closer look at how this works!

Gene regulation using “lac Operon Model” The lac Operon uses a repressor protein as a stop sign until gene is ready to be made

Do you want all your genes turned on if you just need to make one trait? NO!!!!! Eukaryotic RNA is processed before leaving nucleus. “RNA Splicing” Introns – gene segments that are cut out before mRNA leaves nucleus Exons – gene segments that attach to each other that will code for mRNA

http://www. pbslearningmedia. org/resource/tdc02. sci. life. gen http://www.pbslearningmedia.org/resource/tdc02.sci.life.gen.proteinsynth/from-dna-to-protein/