AQA Biology AS Chapter 15 – Evidence for relationships between organisms

Topic Outcomes You should be able to:  Explain the methods of comparing DNA, protein and courtship behaviour of species and when each method is useful.  Interpret data relating to similarities and differences between the base sequences in DNA, as well as in amino acid sequences in proteins, to suggest relationships between organisms.  Explain the example of the evolution of haemoglobin in different organisms.  Recognise the usefulness of courtship rituals between species to ensure a mate is compatible.

Topic Misconceptions  When we look at non-human courtship rituals, remember that animals do not think like humans do  You should be able to explain these rituals using the mallard duck as an example.

Genetic Comparisons using DNA & Proteins  Comparison of DNA base sequences  DNA Hybridisation  Use of DNA bas sequencing to classify plants  Comparison of amino acid sequences in proteins

Comparison of DNA base sequences  When one species gives rise to a new species the DNA of the two species will be very similar.  The differences will be caused by MUTATIONS in the sequence of bases  Therefore the fewer base changes the closer the species are in evolutionary terms AGCTTCGAAG

AGCTTCGAAGAGCTCCGAAGGGCTTCGCAG Point to Note This is purely to demonstrate the concept. In reality the base sequences of organisms can be millions of bases long and therefore mutations are much less subtle and require complex computer programs to identify

DNA Hybridisation  Use the worksheet provided to create a page of notes with a diagram to support the process. The sequence on the sheet is not in the correct order.

 DNA from two species is extracted, purified and cut into short pieces.  The DNA from one of the species is labelled by attaching a radioactive fluorescent marker to it. It is then mixed with unlabelled DNA from the other species.  The mixture of both sets of DNA is heated to separate their strands.  The mixture is cooled to allow the strands to combine with the strands that have a complementary sequence of bases.  Some of the double strands that reform will be made up of one strand from each species. This is called Hybridisation and the new strands are called hybrid strands. These can be easily identified because 50% of the strand is labelled with the radioactive marker.

 These hybrid strands are separated out and the temperature is increased in stages.  At each temperature stage the degree to which the two strands are still linked together is measured.  If the two species are closely related they will share many complementary nucleotide bases.  There will therefore be more Hydrogen Bonds linking them together in the hybrid strand.  The greater the number of Hydrogen bonds, the stronger the hybrid strand will be.

 The stronger the hybrid strand, the higher the temperature that will be needed to separate the hybrid strand into two single strands.  The higher the temperature at which the hybrid strand splits, the more closely the two species are related.  The lower the temperature at which it splits, the more distantly the species are related.

Use of DNA base sequencing to classify plants  Until recently, flowering plants had been classified based on their physical appearance. i.e Monocotyledons and dicotyledons.  What are the drawbacks of this?  Scientists at the Royal Botanical Gardens in Kew, recently devised a new classification based on extended research using the DNA sequences of three genes found in all flowering plants.  Note – Possible career path here. Other work at Kew includes the national seed bank.

The procedure  They used 565 species of plant, that represented all the known families of flowering plant from around the world.  For each of these plants the DNA sequence of the three genes was determined  The sequences for each species were compared using computer analysis.  A phylogenetic tree for the families of the flowering plants was devised based upon the DNA sequences of the species used

Comparison of amino acid sequences in proteins  The sequence of amino acids in a protein is determined by the DNA of the organism.  Therefore when comparing two species the more similar the sequences the more closely related they are.

Immunological comparisons of proteins  Idea behind this method is that antibodies of one species will respond to the antigens found on proteins, such as albumin, (Found in the blood serum) of another species.  Basically the protein from species A will be injected into species B.  Species B will produce antibodies against A  These antibodies will then be injected into the species to be compared.

The process in full  Serum albumin from A is injected into B.  Species B will produce antibodies specific to all the antigen sites on the albumin from species A  Serum is extracted from species B. This serum contains antibodies specific to the antigens for species A Species A

 Serum from species B is then mixed with the blood of a third species.  The antibodies respond to the corresponding antigens on the albumin for species C.  The response is the formation of a precipitate Species C

 The GREATER the number of similar, the MORE precipitate is formed and the more closely the species are related.  The FEWER the number of similar antigens, the LESS precipitate is formed and the more distantly the species are related.

Baboon Dog

Application of Lesson  Using your text book. Read pages 211 and 212.  Complete the questions in full detail, we will mark them NEXT LESSON