Do Now—6.4.15 Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a.

Slides:



Advertisements
Similar presentations
 Like “molecular scissors,” they cut DNA  Hundreds of different ones have been isolated from hundreds of bacteria  Bacteria use them to attack viruses.
Advertisements

GENETIC ENGINEERING. MANIPULATING GENES… Can we make our food taste better? Can we make humans live longer? Can we make X-men like mutants?!? Let’s start.
13-2 Manipulating DNA.
DNA Fingerprinting. Remember! The chemical structure of everyone’s DNA is the same! The only difference between people (or any other organism) is the.
Wiki Study Lectures. Conceptually Reading and analyzing double stranded DNA in base pairs compared to single stranded DNA read in Nucleotides Determining.
DNA Analysis February
(RFLP Electrophoresis)
DNA Fingerprinting Catalyst: What are polymorphisms?
DNA FINGERPRINTS.
1 Chapter 7 Chapter 7 DNA Fingerprinting Learning Goals: o Explain how crime scene evidence is collected and processed to obtain DNA o Describe how radioactive.
Ch. 13.4: DNA Technology Applications
Aim: How do scientists identify people using DNA Fingerprinting?
DNA Fingerprinting or DNA Profiling
POLYMERASE CHAIN REACTION AMPLIFYING DNA What do you need to replicate DNA? umZT5z5R8.
DNA fingerprinting. DNA fingerprinting is used to determine paternity Look at the DNA of the mother, father and child Could these parents produce this.
DNA FINGERPRINTS. No two people in the world have the same DNA (except Identical twins) A majority of DNA is actually the same for all humans. About 0.10.
DNA Profiling in Forensic Science. Introduction DNA Profiling is the analysis of DNA samples to determine if they came from the same individual. Since.
Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.
DNA Technology Chapter 12. Transgenic Organisms Contain recombinant DNA – Nucleotide sequences from 2+ different sources Cells express original AND newly.
Genetics 6: Techniques for Producing and Analyzing DNA.
Image from:
Figure 16.0 Watson and Crick. Figure 16.3 The structure of a DNA stand.
DNA fingerprinting is not taking someone’s fingerprint. It is cutting up a DNA strand and separating them by size.
LEQ: HOW DOES DNA PROFILING WORK? 12.8 to NUCLEIC ACID PROBES  Short single strands of DNA w/ specific nucleotide sequences are created using.
Forensic DNA Analysis Basic Review 46 chromosomes per cell, 23 pairs Humans have approximately 25,000 genes Each gene has multiple versions,
Biology Chapter 9 & Honors Biology Chapter 13 Frontiers Of Biotechnology.
DNA Fingerprinting. Introduction to DNA Fingerprinting Technicians in forensic labs are often asked to do DNA profiling or “fingerprinting” Restriction.
DNA Fingerprinting Gel Electrophoresis Sometimes we comparing DNA from two or more sources. BUT it would take too long to compare all of it!
Biotech. Southern Blotting Through a series of steps, DNA that has been separated by electrophoresis is applied to a membrane of nylon or nitrocellulose.
Genetic Engineering and Biotechnology Notes. IB Assessment Statement 4.4.1Outline the use of polymerase chain reaction (PCR) to copy and amplify minute.
DNA Deoxyribonucleic Acid. DNA Review Genetic material (DNA) is found in the nucleus of cells, and is contained on chromosomes. An organism inherits chromosomes.
DNA TECHNOLOGY. POLYMERASE CHAIN REACTION Polymerase Chain Reaction (PCR) is used to copy and amplify tiny quantities of DNA. When researchers want to.
DNA and Crime. The Crime… Evidence How can we solve this TERRIBLE crime?!? What evidence is available? What can we do with it?
Aim: How do scientists identify people using DNA Fingerprinting?
PCR Polymerase chain reaction. PCR is a method of amplifying (=copy) a target sequence of DNA.
DNA Forensics 352 – O’Dette. Why DNA? DNA is individual evidence DNA links or eliminates a suspect to a crime DNA identifies a victim even if no body.
DNA Fingerprinting Review. Why DNA? DNA is individual evidence DNA links or eliminates a suspect to a crime DNA identifies a victim even if no body is.
Biotechnology. Bell Work 1.You want to determine if a patient with leukemia has a mutation in a certain gene. What type of technology should you use and.
DNA Forensics Bio Interpret how DNA is used for comparison and identification of organisms.
Aim: How do scientists identify people using DNA Fingerprinting?
How do scientists identify people using DNA Fingerprinting?
Biogenetic Engineering
STR Analysis Biology Enriched.
Chapter 9: Biotechnology
Aim: How do scientists identify people using DNA Fingerprinting?
Aim: How do scientists identify people using DNA Fingerprinting?
DNA Forensics Bio Interpret how DNA is used for comparison and identification of organisms.
PCR and RLFP’s.
Biotechnology.
How are areas of DNA that don’t code for proteins (genes) used by our cells? How can we make use of these areas?
Biogenetic Engineering
Biogenetic Engineering
The student is expected to: (6H) describe how techniques such as DNA fingerprinting, genetic modifications, and chromosomal analysis are used to study.
Agenda 4/24 Recombinant DNA warm up Gel Electrophoresis Techniques
DNA ELECTROPHORESIS OR DNA FINGERPRINTING.
Recombinant DNA Unit 12 Lesson 2.
STR Analysis Biology Enriched.
Chapter 13: Biotechnology
IB Biology Monika Siekelova
Chapter 7 DNA Fingerprinting.
Date: January 31th, 2017 Aim #46: How do scientists identify people using DNA Fingerprinting? HW: Daily Review of Class Notes Biotechnology Textbook.
Mrs. Einstein Biology Enriched
Gene Technology Any form of studying genes, DNA, or altering genes to enhance or remove a trait; some forms allow organisms to perform new functions.
DNA Fingerprinting.
History of DNA Fingerprinting
Biotechnology Part 2.
The Indispensable Forensic Tool
DNA Profiling By Derek and Blakely.
DNA Profiling Vocabulary
DNA FINGERPRINTING Gel Electrophoresis
Presentation transcript:

Do Now— Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a score from 1-9)?

Ms. C’s Absence Hi, I’ve been admitted to the hospital. My wound hasn’t healed and the doctor saw the hardware this morning (not good). I’m going to have surgery to have the hardware removed and get IV antibiotics. I’ll be back when I can. Grades are as up to date as possible.

Objective SWBAT analyze DNA profiles created by gel electrophoresis. SWBAT practice micropipetting and loading gels.

DNA Profiling / DNA Fingerprinting ent/labs/gel/ ent/labs/gel/

PCR The polymerase chain reaction (PCR) is used to amplify specific regions of the DNA. The process uses the same enzymes used by cells to replicate DNA and short sections of DNA that act as primers

PCR Forensic Investigation: Suspect DNA should be a complete match with the sample taken from a crime scene if a conviction is to occur

Restriction Fragment Length Polymorphism Restriction enzymes cut DNA at specific spots that are nucleotide sequence-specific. The different cutting pattern will lead to differently sized products that can be separated in gel electrophoresis.

Gel Electrophoresis

DNA is negatively charged Smaller DNA fragments travel further during electrophoresis.

DNA Profiling Paternity Testing: Children inherit half of their alleles from each parent and thus should possess a combination of their parents alleles

DNA Profiling Paternity Testing: Children inherit half of their alleles from each parent and thus should possess a combination of their parents alleles

DNA Profiling Forensic Investigation: Suspect DNA should be a complete match with the sample taken from a crime scene if a conviction is to occur

DNA Profiling Forensic Investigation: Suspect DNA should be a complete match with the sample taken from a crime scene if a conviction is to occur

DNA Profiling Forensic Investigation: Suspect DNA should be a complete match with the sample taken from a crime scene if a conviction is to occur

Classwork Complete the worksheet to the best of your ability… *This worksheet shows single stranded DNA *This restriction enzyme makes a blunt cut

Worksheet Standard CCATCCAAGACATTATGCAGG/CCTAGACTATT ACGGCCATACCAAGG/CCCACTGG/CCAAACAC ACCCATCAGG/CCATGG/CC CCATCCAAGACATTATGCAGGCCTAGACTATTA CGGCCATACCAAGGCCCACTGGCCAAACAC ACCCATCAGGCCATGGCC 21/26/8/18/6/2 Then color the boxes on the sheet that correspond *This worksheet shows single stranded DNA *This restriction enzyme makes a blunt cut

Classwork *This worksheet shows double stranded DNA as it should be *This restriction enzyme makes a sticky cut

Worksheet Ear Phone DNA 6/23/15/3 Then color the boxes on the sheet that correspond GTCGACCGGTGACCGTGCGTACAGTGCTAT CAGCTGGCCACTGGCACGCATGTCACGATA CCGGATAGCTAATAGCTCCGGTG GGCCTATCGATTATCGAGGCCAC *This worksheet shows double stranded DNA as it should be *This restriction enzyme makes a sticky cut GTCGAC CGGTGACCGTGCGTACAGTGCTAT CAGCTGGC CACTGGCACGCATGTCACGATA C CGGATAGCTAATAGCTC CGGTG GGC CTATCGATTATCGAGGC CAC *You count the pairs