Biodiversity. Genetic Mutations Change in base pairs Affect sequence May affect protein production Can alter genetic makeup within species.

Slides:



Advertisements
Similar presentations
Mutations.
Advertisements

Chapter 13.3 (Pgs ): Mutations
ECE 501 Introduction to BME
Mutations.
Introduction  Let’s Read – page 687 paragraph one  What of this to do we agree with?  What don’t we agree with and why?
Regulating Gene Expression Proteins are not required by all cells at all times Eukaryotes – 4 ways – Transcriptional (as mRNA is being synthesized) – Post-
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
Eukaryotic Genomes Demonstrate Sequence Organization Characterized by Repetitive DNA Honors Genetics Lemon Bay High School
5. Point mutations can affect protein structure and function
Mutations.
MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.
Gene and Chromosomal Mutations. What is a mutation? Mutations are changes made to an organism’s genetic material. These changes may be due to errors in.
Mutations Chapter 12.4.
Main Idea #4 Gene Expression is regulated by the cell, and mutations can affect this expression.
Mutations Genetic Changes.
DNA Mutations Mutations are changes to the genetic information of the cell. There are 2 different types of mutations large scale – Chromosome sections.
DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.
Mutations Chapter 12-4.
1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.
Mutations.
Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,
Chapter 2 Genetic Variations. Introduction The human genome contains variations in base sequence from one individual to another. Some sequence variants.
Slide 1 of 24 Copyright Pearson Prentice Hall 12-4 Mutations 12–4 Mutations.
MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.
8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.
Rate of mutations in the Human Genome A study published in Current Biology in 2009, shows that in total, we all carry new mutations in our DNA.
End Show Slide 1 of 24 Copyright Pearson Prentice Hall 12-4 Mutations Outline 12–4: Mutations.
Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.
Genetic Mutations Occur in any organism, from people and other animals to plants, bacteria, fungi, and protists. A mutation is any change in the nucleotide.
Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.
A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.
MOLECULAR GENETICS Mutations Definition
12.4 Assessment Answers.
Mutations 6/26/2018 SB2d.
Chapter 14 GENETIC VARIATION.
A change in the DNA sequence that affects genetic information
Mutations.
GENETIC MUTATIONS Section 5.6 Pg. 259.
Mutations Chapter 12-4.
Types of Mutations.
12- 4 Mutations.
Mutations 12-4.
A change in the DNA sequence that affects genetic information
Mutations Changes in the genetic material Gene Mutations
MUTATIONS 12-4.
Types of point mutations
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
Mutations changes in the DNA sequence that can be inherited
A mutation is a change in an organism’s DNA.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Given a DNA strand ACTTCA, what is the mRNA strand?
12.4 Mutations Kinds of Mutations Significance of Mutations.
Copyright Pearson Prentice Hall
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Gene and Chromosomal Mutations
Mutations Chapter 8.7
Mutation, Natural Selection, and Artificial Selection
MUTATIONS 12-4.
Copyright Pearson Prentice Hall
Mutations.
Copyright Pearson Prentice Hall
Genes & Mutations Miss Richardson SBI4U.
Genetic Mutations.
Section 20.4 Mutations and Genetic Variation
Academic Biology Notes
Changes in DNA TEK 6E: identify and illustrate changes in DNA and evaluate the significance of these changes.
Copyright Pearson Prentice Hall
Mutations Big Q: What are mutations?
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Presentation transcript:

Biodiversity

Genetic Mutations Change in base pairs Affect sequence May affect protein production Can alter genetic makeup within species

Point Mutations Small-scale mutations 4 main types: –Substitution –Insertion –Deletion –Inversion

Large-Scale Mutation Amplified results Multiple nucleotides affected –Regions/genes affected Duplication Deletion Frame shift Translocation

Causes of Genetic Mutation Spontaneous –DNA replication Induced –Mutagens –Chemical –Radiation

Good Mutations Majority are neutral mutations Survival of the fittest Lactose intolerant Sickle-cell anemia

Human Genome Project Over 200 scientists –Coding and non-coding regions <2% proteins 24% introns ~75% DNA –>50% non-functional

Repeating Sequences Variable number tandem repeats (VNTRs) aka microsatellites Telomeres Long interspersed nuclear elements (LINES) Short interspersed nuclear elements (SINES) –Transposons –Pseudogene Dolphins

Homework Page 345 # 1, 2, 6 Page 349 # 1, 3, 5, 8

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.