Year 10, Pathway C 2012.  Define the term mutation  Describe useful and harmful examples of mutations  Describe how mutations occur.

Slides:

Advertisements

Similar presentations

Chapter 13.3 (Pgs ): Mutations

Advertisements

Gene Mutations. Target #17- I can describe a gene mutation Gene mutation: a permanent heritable change in the sequence of bases in DNA – Effect can cause.

SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.

Bacterial Transfer of Genetic Material Mrs. Stewart Medical Interventions.

Mutations Section 12–4 This section describes and compares gene mutations and chromosomal mutations.

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

Connect! Why sometimes do we see albino animals? What causes albinism?

A mutation is a change in an organism’s DNA.

DNA Mutations Biology 6(E).

Sources of Inherited Variation Mutations & Sexual Reproduction.

12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

Mutations 3.29 Recall that mutation is a rare, random change in genetic material that can be inherited. 3.31 Understand that many mutations are harmful.

Mutations And their effects. A mutation is…  A permanent change that occurs in a cell’s DNA.

12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

Objectives Know radiation and mutagenic chemicals increase the mutation rate and can cause genetic diseases and cancer. Application: Consequences of radiation.

Mutations 13.3.

G C T A T A G C T A G C T A G C T A A mutation is a change in the DNA sequence. This may occur by an ‘insertion’, ‘deletion’ or ‘substitution’ of a base.

Mutations A mutation is a mistake in the cell’s DNA. GTTACG  GGTACG.

Mutations What you need to know. Definition of Mutation 1. A random change in an organism’s DNA Can be inherited – passed down from a parent to their.

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

Lesson 5 Cell death, Mutation, Cancer cell. Cell typesAverage life span Brain30-50 years Red blood120 days Stomach lining2 days Liver200 days Intestine.

Human Inheritance & Genetic Mutations

Holy Family Catholic High School 17th April 2007 Developing medicines + Immunity UNIT 11.4 Controlling infectious disease Form 10 A4.

Genetic Disorders Genetic Mutations Because DNA controls characteristics of a cell it must be copied before a cell reproduces Sometimes mistakes occur.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

13.3 Mutations. POINT > Define a gene in simple terms POINT > Define and describe genetic mutations POINT > Distinguish between gene and chromosomal mutations.

Reality Science Fiction! Just silly.. 1. Some mutations affect a single gene, while others affect an entire chromosome. 2. A mutation is a change in an.

DNA and Mutations. What is DNA? DNA (Deoxyribonucleic acid) is found in all living things. It is the carrier of genetic information.

 BUILD-A-BUG ACTIVITY  Build your bug and turn in to your box  Mutations Notes  Mutations practice QUIZ NEXT CLASS: Transcription and Translation TUESDAY.

8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.

Genetics Lesson 4 Mutations.

Changes in DNA can cause changes in phenotype.

A mutation is a change in an organism’s DNA.

Mutations Add to Table of Contents – p. 14

Mutations TSW identify and describe the various types of mutations and their effects.

Molecular Phylogenetics

DNA Mutations & Technology

Mutations 7.L.4A.5 Construct scientific arguments using evidence to support claims for how changes in genes (mutations) may have beneficial, harmful,

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

The DNA Code How does DNA affect living things?

Genetic Mutations.

Genetically Modified Organisms Science – 7th Grade

A ____________ is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mechanisms for the Diversity of Life

Cell Divisions & Mutations

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutations We WILL: dEFINE MUTATIONS AND DESCRIBE THE DIFFERENT TYPES You Will: UNDERSTAND THE EFFECTS MUTATIONS CAN HAVE ON GENES.

Mutations Chapter 8.7.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

13.3 Mutations.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Genetic Variation MT: Allele Frequency.

Mutations: Changes in Genes

Presentation transcript:

Year 10, Pathway C 2012

 Define the term mutation  Describe useful and harmful examples of mutations  Describe how mutations occur

 A mutation is a change in the genes (DNA) caused by radiation or chemicals

 Mutations may be beneficial to an individual  Lactose tolerance  Resistance to antibiotics  Mutations may be harmful to an individual  Seedless grapes  Cancer  Mutations may do nothing!

 Mutations may be beneficial to an individual  Lactose tolerance  Resistance to antibiotics  Mutations may be harmful to an individual  Seedless grapes  Cancer  Mutations may do nothing or not be influential!  Blue eyes

 Mutations are caused by:  Radiation  Chemicals

 Define the term mutation  Describe useful and harmful examples of mutations  Describe how mutations occur