MUTATIONS 12.4. I. VOCABULARY A. Mutation- Any change in the ____ sequence. 1. Mutations in body cells may cause _ to be made wrong or not.

Slides:

Advertisements

Similar presentations

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Advertisements

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

Mutations and Karyotyping

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Chapter 11.3 Genetic Changes.

C11- DNA and Genes Chapter 11.

Genetic Changes 11.3.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Review: DNA, Transcription & Translation

Gene Mutations Chapter 11.

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

Section 11.3 Genetic Changes.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

Mutations that happen during Transcription and Translation

DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.

DNA (Gene) Mutations. What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

Chapter 11 DNA. What is DNA? Living things need proteins to survive. –most proteins are enzymes DNA provides the complete set of instructions for making.

From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

12.4 Mutations.  What is a mutation and where can it occur? Inheritable change in genetic code 99.9 % are harmful, only 0.1% are helpful  Any change.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

Mutation Notes: Chapter 11.

Section 11.3: Genetic Changes

11.3 Mutations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mermaid Syndrome Video.

Gene Mutations Chapter 11.

Genetic Mutations.

Protein Synthesis.

Mutations LN #23 Ms. Garcia California Content Standard Genetics

To be successful today…

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Mutations A mutation is any change in the DNA sequence.

Gene and Chromosomal Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutations A mutation is any change in the DNA sequence.

Draw a conclusion from this graph for both the red and blue line

10th Grade Biology Mr. Walker

11.3 Section Objectives – page 296

Presentation transcript:

MUTATIONS 12.4

I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not at all.

I. VOCABULARY A. Mutation (cont.) 2. When the body cell divides, new cells will have the same mutation. a. May cause cells to grow & divide rapidly (_______)

I. VOCABULARY A. Mutation (cont.) b. Body cell mutations are NOT passed to the _____________. c. A build up of mutated cells may cause ________

I. VOCABULARY A. Mutation (cont.) 3. Mutations in sex cells ARE passed to the offspring a. Embryo may ___________ b. May have _____________ c. Could be beneficial!

I. VOCABULARY B. Point Mutation- A change or SUBSTITUTION of a single base pair of DNA. 1. AKA “_____” Mutations 2. May or may not change the amino acid/_________

I. VOCABULARY B. Point Mutation (cont.) 3. Example: THE DOG BIT THE CAR THE DOG BIT THE CAT

I. VOCABULARY C. Frameshift Mutation- Mutation in which a single base is __________ or __________. 1. Causes the entire DNA sequence to shift 2. Generally more __________!

I. VOCABULARY 3. Example: THE DOG BIT THE CAT (mutation: Delete 1 st G) THE DOB ITT HECAT

I. VOCABULARY D. Chromosomal Mutation- Mutation that occurs at the _____________ level. 1. Changes gene distribution in _____________ 2. Chromosomes break off or rejoin incorrectly.

I. VOCABULARY a) Deletion (one base taken away) b) __________ (one base added) c) ___________ (bases are flipped around) d) Translocation (a piece breaks off and joins another __________)

II. CAUSES OF MUTATIONS A. Mutagen- Any agent that can cause a change in _________.

II. CAUSES OF MUTATIONS A. Mutagen-(cont.) 1. Radiation (X rays, UV light, cosmic rays, nuclear radiation). a. Radiation badges & __________ monitor exposure in nuclear power plants

II. CAUSES OF MUTATIONS A. Mutagen-(cont.) 2. Chemical (dioxins, asbestos, benzene & formaldehyde) a. Often found _________

III. REPAIRING DNA A. DNA is often repaired ____________! B. Enzymes “proofread” DNA and replace incorrect ______________

III. REPAIRING DNA 1. Greater exposure to mutagens such as UV light makes it hard for ________ to keep up. a. Humans should avoid mutagens if possible!!!

IV. REVIEW Define mutationDefine mutation Which is more dangerous, point mutations or frameshift mutations?Which is more dangerous, point mutations or frameshift mutations? Why are point mutations often called “silent”?Why are point mutations often called “silent”?

IV. REVIEW What is a chromosomal mutation?What is a chromosomal mutation? Give an example of a mutagen.Give an example of a mutagen. What “proofreads” DNA for mistakes?What “proofreads” DNA for mistakes?