Forensic DNA Analysis
Basic Review 46 chromosomes per cell, 23 pairs Humans have approximately 25,000 genes Each gene has multiple versions, called alleles (ex: hair color=gene, alleles=brown, blonde, etc.)
DNA Structure Review DNA is made of 4 nucleotides connected by a sugar-phosphate backbone Adenine-Thymine Guanine-Cytosine 3.2 Billion base pairs in each cell
Common Sources of DNA at a Crime Scene Hair Skin cells Blood Semen Cigarettes Clothing Envelope Glass/bottle
How to match DNA to suspect? Main limitation of DNA evidence?
How to match DNA to suspect? Main limitation of DNA evidence? Sample size - Millions of copies of DNA sample needed to perform tests
How to match DNA to suspect? Main limitation of DNA evidence? Sample size - Millions of copies of DNA sample needed to perform tests Solution??
How to match DNA to suspect? Main limitation of DNA evidence? Sample size - Millions of copies of DNA sample needed to perform tests Solution?? Polymerase Chain Reaction (PCR)
DNA Polymerase = enzyme that builds new DNA strand one base pair at a time PCR allows the production of a billion+ copies of a DNA strand in a few hours
Gel Electrophoresis Goal of G.E. is to separate sample DNA into bands that allow comparison between individuals
Process of G. E. 1. PCR 2. DNA cut with restriction enzyme, a molecule that cuts DNA at specific base pair sequences 3. DNA loaded into gel, attracted to positive end due to negative charge 4. DNA strands separate based on size (restriction fragment length) 5. Labeled radioactively or with dye, compared to known standard for analysis
Reading a DNA Fingerprint
Short Tandem Repeats 30% of DNA is made up of repeating segments called Short Tandem Repeats Ex. GATTACGACGACGACGTATTGGA
Short Tandem Repeats 30% of DNA is made up of repeating segments called Short Tandem Repeats Ex. GATTACGACGACGACGTATTGGA STRs have no known function, seem to act as filler between genes
STR Analyis STRs have become the most successful and widely used form of forensic DNA analysis STR lengths (# of repeats) vary from individual to individual # of repeats for a variety of STRs tested can positively ID a suspect or victim
STR Analysis Thirteen STRs are listed in the CODIS DNA database Each has a known probability of occurrence By testing multiple STRs, a sample can be identified along with its frequency of occurance Ex: 3.5% chance of STR combo #1, 0.7% chance of combo #2, 1.3% of combo #3 Total likelihood of combination = % or 1 in 3,000 people would share same STR
Advantages of STR Analysis Need as few as 18 cells Faster – look at only a small portion of DNA, as STRs are >450 base pairs long out of 3,200,000,000 Cheaper Highly discriminate Looking at all 13 CODIS STRs gives odds of 1 in 575 trillion for caucasians, 1 in 900 trillion for african americans ( % chance of random match)
Mitochondrial DNA 99% of DNA is found within cell’s nucleus, but small amount of DNA found inside mitochondria Mitochondria are responsible for supplying energy to the cell
Forensic Mitochondrial DNA Analysis Mitochondrial DNA is only inherited from mother - identical from generation to generation and among siblings Disadvantage: Not as many variations as nuclear DNA, thus not as specific to individual Advantage: Doesn’t degrade as quickly as nuclear DNA Useful for old, skelontonized remains, mass graves, lost soldiers, etc.