DNA & RNA Chapter 13 Protein Synthesis

DNA Deoxyribonucleic Acid RNA Ribonucleic Acid

Where does DNA “live”? The NUCLEUS!

Why is DNA so Important? * DNA i s a nucleic acid that contains the genetic information used in the development and functioning of all living things and some viruses. * DNA is like blueprints, instructions, or a code for making proteins * DNA’s codes are converted/changed into messages (mRNA) for ribosomes to read and then make proteins. * Proteins do most of the hard work of keeping us alive.

What are the parts of DNA? * D = Deoxyribose (SUGAR) P = Phosphate The “Backbone” Has 2 Parts 2 Strands called: Double Helix

What are the parts of DNA? * The “Rungs” The Nitrogen Bases A = Adenine T = Thymine C = Cytosine G = Guanine A - T C - G

How to remember Nitrogen Bonds: A bonds with T Think: A T & T phone company

How to remember Nitrogen Bonds: C bonds with G Think: Half circles

These are 2 examples of nucleic acids: A. Chloroplasts & Mitochondria B. Carbohydrates & Lipids C. DNA & RNA D. Nucleus & Ribosomes Clicker Question #1

DNA holds the instructions for making: A. Energy B. Proteins C. Carbon dioxide D. Deoxyribose Clicker Question #2

If 20% of a DNA’s strand contains Thymine, then: A. it also has 80% Guanine B. it also has 50% Cytosine C. it also has 80% Adenine D. it also has 20% Adenine Clicker Question #3

What type of sugar is found in DNA? A. Phosphorous B. Thymine C. Ribose D. Deoxyribose Clicker Question #4

The DNA’s code is converted into _____ so it can be sent to ribosomes to make the proteins. A. DNA B. mRNA C. tRNA D. ATP Clicker Question #5

What are the parts of DNA? * Nucleotides: 1 Sugar 1 Phosphate 1 Nitrogen Base

Let’s Practice: What are the complementary nitrogen bases in this sequence of DNA? ATT CGT TAT CGT CTG AAA ACG TAAGCAATAGCAGACTTTTGC What did we just do? Yes! We made DNA!

Why is mRNA Important? * mRNA is created by DNA in the nucleus. * mRNA contains the messages from the DNA and are sent to ribosomes for them to read the instructions for making proteins. * DNA is too big and CAN’T leave the nucleus…it must send messages.

What are the parts of RNA? * Just Like DNA, RNA has: Sugar Phosphate Nitrogen Base BUT….. RNA is Made of: Ribose (SUGAR) Phosphate (same as DNA) Nitrogen Bases (A,U, C, G) First: Notice that RNA has 1 Strand! NO THYMINE in RNA!! U stands for Uracil…. a different nitrogen base

RNA Nitrogen Bases: A bonds with U C bonds with G THYMINE in RNA!!

What 3 things make up a nucleotide? A. Nucleus, DNA, & RNA B. Adenine, Thymine, & Cytosine C. Sugar, Phosphate, & a Nitrogen base D. Chromosomes, Genes, & DNA Clicker Question #6

Where is mRNA made? A. In the nucleus B. In the cytoplasm C. In the mitochondria D. In the ribosomes Clicker Question #7

What type of sugar does RNA have? A. Deoxyribose B. Carbohydrate C. Ribonucleic acid D. Ribose Clicker Question #8

Which of the following nitrogen bases does RNA not have? A. Uracil B. Thymine C. Adenine D. Cytosine Clicker Question #9

If a strand of DNA contains 40% of Cytosine, then A. it also contains 40% Guanine B. it also contains 60% Thymine C. it also contains 40% Cytosine D. it also contains 60% Guanine Clicker Question #10

How does DNA tell the cell to make a specific kind of protein? * First: Transcription * Second: Translation * There are 2 major steps in this process

How does DNA tell the cell to make a specific kind of protein? Transcription : Process in which mRNA is synthesized from the DNA template. * mRNA : ( messenger RNA) holds the recipe for making proteins. *** Transcription is when mRNA is made from DNA.*** HINT:

How does Transcription work? * QUESTION…have you been to court? * There is a person typing what is said and is creating a “court transcript”…which is really a code…shortened version…and later the transcript is translated into all the words that were said for a record. SHORTENED CODE = mRNA

Let’s Practice: Create an RNA strand using this sequence of DNA? ATT CGT TAT CGT CTG AAA ACG UAAGCA AUA GCAGACUUUUGC We just transcribed DNA into mRNA! This is mRNA!

What does mRNA do? A. It carries the instructions from DNA to ribosomes to make proteins B. It carries instructions from the ribosomes to the nucleus to make DNA C. It carries the instructions from the nucleus to the mitochondria to make energy D. It carries instructions from the nucleus to the cytoplasm to make energy Clicker Question #11

What is transcription? A. The process of making energy B. The process of making proteins C. The process of making DNA D. The process of making mRNA Clicker Question #12

Let’s Practice This Again: Create an RNA strand using this sequence of DNA? ACA CGA TTA CGG ATA CGC ATC UGU GCU AAUGCCUAU GCG UAG What did we just do? YES! We transcribed/made mRNA from DNA. Now what?

Now What?...Translation! Translation : Process in which mRNA attaches to the ribosome and a protein is assembled/made. * Codon : 3 base code in DNA or RNA Words to know: * Amino Acid : Compounds joined by peptide bonds to build proteins * Ribosome : “Reads” mRNA recipes so it can synthesize/make proteins ACG ATA CGG CTT There are 20 different Amino Acids. Different combination of Amino Acids make different kinds of proteins.

Now What?...Translation! * tRNA : (transfer RNA) Type of RNA that transports amino acids to the ribosome More Words to know: * Anticodon : Nitrogen bases that can pair that corresponds with the codons on the mRNA tRNA Amino Acid Anticodon

What happens during translation? Ribosome Peptide chain/ Protein Chain tRNA Amino Acid Anticodon Codon

Where does translation occur? A. In the nucleus B. In the mitochondria C. In the DNA D. In the ribosome Clicker Question #13

What is made during translation? A. DNA B. mRNA C. Protein D. Energy Clicker Question #14

What is another name for polypeptide chain? A. Protein chain B. Carbohydrate chain C. Lipid chain D. Nucleic acid Clicker Question #15

#1. AUG GCA UCC UGA Methionine, Alanine, Serine, Stop #2. AUG CCC GGU UAG Methionine, Proline, Glycine, Stop #3. AUG AAG GUG UGA Methionine, Lysine, Valine, Stop Translating mRNA codes into amino acids to create polypeptid chains (protein chains)

What is the amino acid for the following codons? AAU Asparagine (Asn) GUG Valine (Val) UGG Tryptophan (Trp)

How can knowing amino acid sequences in organisms help biologists? We can use the sequences to see how organisms are related! Fish Sequence: Methionine, Isoleucine, Arginine, Isoleucine, Glycine, Serine Frog Sequence: Methionine, Isoleucine, Serine, Leuicine, Lysine, Lysine Bird Sequence: Methionine, Isoleucine, Serine, Glycine, Alanine, Valine Lizard Sequence: Methionine, Isoleucine, Serine, Glycine, Alanine, Tyrosine Which of the following two organisms are MOST closely related?

Transcription Video….

The end… For now…

DNA Mutations & Technology

What are genetic mutations? Mutation: Permanent change in a cell’s DNA, ranging from changes in a single base pair to deletions of large sections of chromosomes. Causes of mutations include: * Viruses * Radiation * Chemicals * Errors during mitosis and meiosis

Are mutations harmful? Some mutations are harmful, some are beneficial, and some do nothing. Harmful example: - Some mutations cause cancer & genetic disorders

Are mutations harmful? Helpful example: - Sickle cell anemia prevents malaria

Are mutations harmful? Not harmful or helpful: - Peppered moths come in dark or light colors

What are some types of mutations? There are many different types…we will do an activity that demonstrates these mutations: 1. Insertion

What are some types of mutations? 2. Deletion

What are some types of mutations? 3. Translocation

What are some types of mutations? 4. Duplication

How has technology changed DNA? Genetic Engineering: Technology used to manipulate an organism’s DNA by inserting the DNA of another organism. Transgenic Organism: Organism that is genetically engineered by inserting a gene from another organism.

How has technology changed DNA? Gel Electrophoresis: Process that involves using electric current to separate certain biological molecules by size. We use this to see DNA fragments to create a DNA fingerprint -DNA fingerprints have 2 major uses: 1.Solve crimes 2.Figuring out “who’s the baby’s daddy”

DNA Fingerprinting Which of the following are his/her parents? Who did it?

What is the human genome? Genome: Total DNA in each cell nucleus of an organism The Human Genome Project: * Began in 1990 and completed in 2003 * Found that we have 3 BILLION chemical base pairs * Used to understand genetic disorders and to them

What is cloning? Cloning: Process in which large numbers of identical recombinant DNA molecules are produced. “Dolly” the sheep was the first cloned animal