From Gene to Protein How Genes Work 2007-2008

Making proteins Organelles nucleus ribosomes endoplasmic reticulum (ER) Golgi apparatus vesicles small ribosomal subunit nuclear pore mRNA large ribosomal subunit cytoplasm

Nucleus & Nucleolus

Nucleolus Function ribosome production build ribosome subunits from rRNA & proteins exit through nuclear pores to cytoplasm & combine to form functional ribosomes small subunit large subunit ribosome rRNA & proteins nucleolus

Ribosomes Function Structure protein production rRNA & protein small subunit large Ribosomes Function protein production Structure rRNA & protein 2 subunits combine 0.08m Ribosomes Rough ER Smooth The genes for rRNA have the greatest commonality among all living things. There is very little difference in the DNA sequence of the rRNA genes in a humans vs. a bacteria. Means that this function (building of a ribosome) is so integral to life that every cell does it almost exactly the same way. Change a base and this changes the structure of the RNA which causes it to not function. rRNA genes are always turned on.

Types of Ribosomes Free ribosomes Bound ribosomes suspended in cytosol synthesize proteins that function in cytosol Bound ribosomes attached to endoplasmic reticulum synthesize proteins for export or for membranes membrane proteins

endoplasmic reticulum TO: nucleus protein on its way! TO: DNA RNA vesicle TO: TO: vesicle ribosomes TO: protein finished protein Golgi apparatus Making Proteins

TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTA What happens in the cell when a gene is read? Where are the genes? Where does a gene start? Where does the gene end? How do cells make proteins from DNA? How is one gene read and another one not? How do proteins create phenotype?

Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E     enzyme 1 enzyme 2 enzyme 3 enzyme 4

hydroxyphenylpyruvic acid maleylacetoacetic acid ingested protein digestion phenylalanine PKU phenylketonuria phenylalanine hydroxylase tyrosine albinism melanin transaminase cretinism thyroxine hydroxyphenylpyruvic acid hydroxyphenylpyruvic acid oxidase tyrosinosis homogentisic acid homogentisic acid oxidase alkaptonuria maleylacetoacetic acid CO2 & H2O

1 gene – 1 enzyme hypothesis Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break DNA damage a gene wild type grows on minimal media sugars + required nutrients allows fungus to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme needed to produce a certain amino acid non-functional enzyme from damaged gene

Beadle & Tatum Wild-type Neurospora Minimal medium Select one of the spores Grow on complete medium control Nucleic acid Choline Pyridoxine Riboflavin Arginine Minimal media supplemented only with… Thiamine Folic Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete X rays or ultraviolet light asexual spores create mutations positive control negative control mutation identified experimentals amino acid supplements

One gene / one enzyme hypothesis Damage to specific gene, mapped to nutritional mutations gene cluster 1 gene cluster 2 gene cluster 3 chromosome arg-E arg-G arg-H arg-F encoded enzyme enzyme E enzyme F enzyme G enzyme H glutamate ornithine citruline argino- succinate arginine substrate in biochemical pathway gene that was damaged

one gene : one enzyme hypothesis 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

DNA gets all the glory, but proteins do all the work! The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work! replication

DNA RNA RNA ribose sugar N-bases single stranded lots of RNAs uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

from DNA nucleic acid language to RNA nucleic acid language Transcription from DNA nucleic acid language to RNA nucleic acid language 2007-2008

Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

Transcription in Prokaryotes Bacterial chromosome Transcription in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall 2007-2008

Transcription in Prokaryotes Initiation RNA polymerase binds to promoter sequence on DNA Role of promoter Starting point where to start reading start of gene Template strand which strand to read Direction on DNA always read DNA 35 build RNA 53

Transcription in Prokaryotes Promoter sequences enzyme subunit RNA polymerase read DNA 35 bacterial DNA Promoter TTGACA TATAAT –35 sequence –10 sequence RNA polymerase molecules bound to bacterial DNA RNA polymerase strong vs. weak promoters

Transcription in Prokaryotes Elongation RNA polymerase copies DNA as it unwinds ~20 base pairs at a time 300-500 bases in gene builds RNA 53 Simple proofreading 1 error/105 bases make many mRNAs mRNA has short life not worth editing! reads DNA 35

Transcription in Prokaryotes Termination RNA polymerase stops at termination sequence RNA GC hairpin turn

Transcription in Eukaryotes RNA Processing Psssst… DNA can’t leave nucleus! Translation Protein 2007-2008

Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Transcription in Eukaryotes 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes

Transcription in Eukaryotes Initiation complex transcription factors bind to promoter region upstream of gene suite of proteins which bind to DNA turn on or off transcription TATA box binding site recognition site for transcription factors transcription factors trigger the binding of RNA polymerase to DNA

Post-transcriptional processing Primary transcript (pre-mRNA) eukaryotic mRNA needs work after transcription mRNA processing (making mature mRNA) mRNA splicing = edit out introns protect mRNA from enzymes in cytoplasm add 5 cap add polyA tail 3' poly-A tail 3' A A A A A 5' cap mRNA 50-250 A’s P P P 5' G eukaryotic RNA is about 10% of eukaryotic gene. intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

Splicing must be accurate No room for mistakes! splicing must be exactly accurate a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

we just broke a biological “rule”! Whoa! I think we just broke a biological “rule”! Splicing enzymes snRNPs small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste snRNPs exon intron snRNA 5' 3' spliceosome exon excised intron 5' 3' lariat mature mRNA No, not smurfs! “snurps”

Ribozyme 1982 | 1989 RNA as ribozyme some mRNA can even splice itself RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language 2007-2008

Translation Codons blocks of 3 nucleotides decoded into the sequence of amino acids

Translation in Prokaryotes Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall 2007-2008

Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing

Translation in Eukaryotes 2007-2008

DNA mRNA protein From gene to protein transcription translation aa transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores ribosome proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT 1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine (phe)

The code Code for ALL life! Code is redundant Start codon Stop codons strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 tRNA UAC Met GCA Arg amino acid CAU Val anti-codon

DNA mRNA protein From gene to protein transcription translation aa transcription translation DNA mRNA protein ribosome nucleus cytoplasm

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A

Building a polypeptide 1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting Signal peptide address label start of a secretory pathway

Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

Got Questions? Can I translate that for you? 2007-2008