Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin.

Slides:

Advertisements

Similar presentations

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Advertisements

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

MCB 317 Genetics and Genomics MCB 317 Topic 10, part 1 A Story of Transcription.

Making a Restriction Map

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

Chap. 7 Problem 1 In glucose media without lactose, the lac repressor is bound to the lac operator, and the CAP protein is not bound to its control site.

Figure S1: Ma et al., 2015 Supplementary Data 1: Southern blot of three individual plants per generation (T5, T6 and T7), following the digestion of genomic.

Lecture 7 Manipulation of foreign gene and secretion of foreign protein.

(A) RdRP 5‘UTR3‘UTR CP MP SP6 (B) (C) 3 dpi 15 dpi (D) Supplementary Figure 1 Infectivity analysis of Nicotiana tabacum. Schematic illustration of the.

Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.

Analysis Restriction enzyme mapping Plasmid one site / one cut Full length Plasmid Y X Z A + B = Full length B Plasmid.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

P Xa13 :GUSP xa13 :GUS Supplemental Figure 1  -glucuronidase (GUS) expression regulated by the promoters of dominant Xa13 (P Xa13 ) and recessive xa13.

Supporting Fig. S1 OsRHR-GFP GFP ChlorophyllMerge GC Hoechst Merge GH Supporting Figure S1. The OsPHR-GFP fusion protein localizes to nuclei, chloroplasts,

Leimgruber et al. Supplementary Figure 1 Supplementary Figure 1. The S’-Y’ and S-Y modules of the HLA-DRA gene exhibit lower levels of H4Ac, reduced nucleosome.

Fire-fly luciferase Light Signal transduction Signals luciferase luciferin Genetic Screens in Arabidopsis: Luciferase screening for gene discovery CCD.

Part Two and Three The Applications of Gene Cloning and DNA Analysis in Research and Biotechnology Chapter 10. Studying gene location and structure Chapter.

Cui-Cui Zhang, Wen-Ya Yuan, Qi-Fa Zhang Molecular Plant

Table A. Sequences used in making CsKASII RNAi constructs

Supplemental Figure 1 A) B) C)

Figure 2 Analysis of restriction sites that define the 5′ and 3′ boundaries of the region of identity between RHD and the Ce allele. TaqI (a) and HinfI.

Restriction Enzymes and Plasmid Mapping

Generation of transgenic mice using lentiviral vectors: a novel preclinical assessment of lentiviral vectors for gene therapy Masahito Ikawa, Nobushige.

Volume 129, Issue 5, Pages (November 2005)

Levels of Polyadenylation Factor CstF-64 Control IgM Heavy Chain mRNA Accumulation and Other Events Associated with B Cell Differentiation Yoshio Takagaki,

Volume 3, Issue 1, Pages (January 1999)

Volume 26, Issue 1, Pages (April 2007)

Robert E. White, Richard Wade-Martins, Michael R. James

Mutation of a Nuclear Respiratory Factor 2 Binding Site in the 5′ Untranslated Region of the ADSL Gene in Three Patients with Adenylosuccinate Lyase Deficiency

Volume 7, Issue 3, Pages (March 2010)

Generation of transgenic mice using lentiviral vectors: a novel preclinical assessment of lentiviral vectors for gene therapy Masahito Ikawa, Nobushige.

Volume 15, Issue 1, Pages (July 2001)

The 130-bp key region of the promoter of TsVP1 is a direct binding target of TsNAC1. The 130-bp key region of the promoter of TsVP1 is a direct binding.

Adam C Bell, Adam G West, Gary Felsenfeld Cell

Volume 14, Issue 9, Pages (May 2004)

Short Telomeres in Yeast Are Highly Recombinogenic

Fuqing Wu, David J. Menn, Xiao Wang Chemistry & Biology

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Volume 22, Issue 2, Pages (February 2014)

Unbiased Proteomic Profiling Strategy for Discovery of Bacterial Effector Proteins Reveals that Salmonella Protein PheA Is a Host Cell Cycle Regulator

Volume 10, Issue 7, Pages (July 2017)

Tamar Ratner, Ron Piran, Natasha Jonoska, Ehud Keinan

Transcriptional Regulation of ATP2C1 Gene by Sp1 and YY1 and Reduced Function of its Promoter in Hailey–Hailey Disease Keratinocytes Hiroshi Kawada,

Molecular Biotechnology

Loss of E2F7 Expression Is an Early Event in Squamous Differentiation and Causes Derepression of the Key Differentiation Activator Sp1 Mehlika Hazar-Rethinam,

Volume 115, Issue 2, Pages (August 1998)

Volume 2, Issue 1, Pages (July 1998)

Regulation of the Expression of Peptidylarginine Deiminase Type II Gene (PADI2) in Human Keratinocytes Involves Sp1 and Sp3 Transcription Factors Sijun.

Volume 127, Issue 4, Pages (October 2004)

Demethylation, Reactivation, and Destabilization of Human Fragile X Full-Mutation Alleles in Mouse Embryocarcinoma Cells Doris Wöhrle, Ulrike Salat,

Volume 26, Issue 1, Pages (April 2007)

Magalie Lecourtois, François Schweisguth Current Biology

Volume 1, Issue 2, Pages (January 1998)

Identification of Rare, Disease-Associated Variants in the Promoter Region of the RNF114 Psoriasis Susceptibility Gene Alexandros Onoufriadis, Michael.

Volume 8, Issue 1, Pages (January 1998)

Abridged Genetic Engineering Pathway (Original “A” Sequence)

Volume 7, Issue 12, Pages (December 2014)

Targeting strategy and molecular verification of myoglobin disruption.

Lawrence M. Pfeffer, Andrzej T. Slominski

Figure S1. Schematic representation of the RieskeFeS over-expression vector pGWRi used to transform Arabidopsis (Col-0). cDNA are under transcriptional.

Nuclear factors, hs1,2 enhancer and IgA nephropathy

Fig. 2. Mapping of the interaction domain on coilin for association with the dyskerin complex. Mapping of the interaction domain on coilin for association.

Cui-Cui Zhang, Wen-Ya Yuan, Qi-Fa Zhang Molecular Plant

Gene transfer to plants – vectors and strategies

Bart A. Jessen, Marjorie A. Phillips, Robert H. Rice

Volume 9, Issue 4, Pages (April 2016)

BHLHB2 is part of a protein–DNA complex associated with the proximal E-box element of Bdnf promoter 4. BHLHB2 is part of a protein–DNA complex associated.

Volume 3, Issue 1, Pages (January 1999)

Effect of vd-sRNA on CalS12-like mRNA

Presentation transcript:

Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin phosphotransferase gene; GFP, green fluorescent protein gene; P WRKY13, rice OsWRKY13 promoter; NOS, napoline synthase polyadenylation signal. RB P WRKY13 target gene GFP NOS Hpt LB HindIII PstI BamHI EcoRI

Figure S2. Gel mobility shift assays. The electrophoresis was performed with the gel plates of 6 cm in length, which could not clearly distinguish different sizes of DNA- protein complexes. The nuclear proteins were from 8 h after mock-inoculated (control) or JL691- inoculated Mudanjiang 8. DNA probes are 39- to 51-bp in length (Supplemental Table 2). (a) D53I8 D53I10D53I12D53I14 D53I16D53I18D53I20D53I22D53I24 Mock inoculation D53I8 D53I10D53I12D53I14 D53I16 D53I18 D53I20 D53I22D53I24 Pathogen (JL691) inoculation

D53I12-1 (pathogen inoculation)D53I12-2 (pathogen inoculation) D53I16-1 (pathogen inoculation) D53I16-2 (pathogen inoculation) To determine the pathogen-responsive DNA-protein binding regions in probes D53I12 and D53I16 as shown in Supplemental Fig. 2a, four 17- to 25-bp probes (Supplemental Table 2) from the two long probes were examined for their binding ability to nuclear proteins from pathogen-inoculated rice cultivar Mudanjiang 8. The gel mobility shift assay shows that D53I8-1, D53I12-1 do not contain protein- binding site and D53I12-2, D53I16-1 and D53I16-2 contain protein-binding sites. (b)

To further define the pathogen-responsive DNA-protein binding regions in probes D53I12-2 and D54I16-2 as shown in Supplemental Fig. 2b, four 9- to 13-bp probes (Supplementary Table 2) from the two long probes were examined for their binding ability to nuclear proteins from pathogen-inoculated rice cultivar Mudanjiang 8. The gel mobility shift assay shows that D53I12-2-1, D53I and D53I contain protein-binding sites and D53I do not contain protein-binding site. D53I (pathogen inoculation)D53I (pathogen inoculation)D53I (pathogen inoculation) D53I (pathogen inoculation) (c)

To further define the pathogen-responsive DNA-protein binding regions in probes D53I12-2-1and D53I as shown in Supplemental Fig. 2c, six 5- to 7-bp probes (Supplementary Table 2) from the two long probes were examined for their binding ability to nuclear proteins from pathogen-inoculated rice cultivar Mudanjiang 8. The gel mobility shift assays show that all the probes contain protein-binding sites, indicating that the protein-binding sites in the two probes shown in Supplemental Fig. 1C can not be further defined. (d) D53I (pathogen inoculation)D53I (pathogen inoculation)D53I (pathogen inoculation)D53I (pathogen inoculation)D53I (pathogen inoculation)D53I (pathogen inoculation)

(e) D53I (M) D53I (P) D53I (P) D53I (M) The nuclear proteins were from 8 h after mock-inoculated (M, control) or pathogen (JL691)-inoculated (P) Mudanjiang 8. The gel mobility shift assay shows that D53I and D53I contain protein-binding sites, which have the same protein binding patterns as D53I12 and D54I16 shown in Supplemental Fig. 2a.