Chapter 21 Genomics Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

A 1 Cytogenetic map: Linkage map: Physical map: sc (1A8)w (3B6) wsc 1.5 mu w sc ~ 2.4 x 10 6 bp BCDEFAAABBB CCC DDEEFF Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Brooker, Figure 21.1 Obtained from analysis of polytene chromosomes The results from each type of mapping technique may be slightly different Three types of maps associated with the Genome

Figure 21.2 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Sister chromatids Treat cells with agents that make them swell and fixes them onto slide. Denatured DNA (not in a double- helix form) Add single-stranded DNA probes that have biotin incorporated into them. Denature chromosomal DNA. Hybridized probe View with a fluorescence microscope. Fluorescent molecule bound to probe Add fluorescently labeled avidin, which binds to biotin. Fluorescence in situ hybridization

Figure 21.4 EcoRI sites PRESENT on both chromosomes EcoRI sites ABSENT from both chromosomes Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Region of two homologous chromosomes from individual 1 EcoRI Region of two homologous chromosomes from individual 2 EcoRI 2000 bp5000 bp1500 bp 3000 bp 2500 bp 2000 bp5000 bp1500 bp3000 bp2500 bp 2000 bp5000 bp4500 bp2500 bp 2000 bp5000 bp4500 bp2500 bp

EcoRI site found only on one chromosome The three individuals share many DNA fragments that are identical in size. Indeed, if these segments are found in 99% of individuals in the population, they are termed monomorphic Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Figure bp 4500 bp 3000 bp 2000 bp 2500 bp 1500 bp Polymorphic bands are indicated at the arrows. Separate the DNA fragments by gel electrophoresis. Cut the DNA from all 3 individuals with EcoRI. Region of two homologous chromosomes from individual 3 EcoRI 2000 bp 5000 bp1500 bp 3000 bp 2500 bp EcoRI 2000 bp 5000 bp4500 bp2500 bp Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Southern Blotting of RFLP Figure not in Brooker

RFLPs (and other markers) can be mapped Figure not in Brooker

Short Tandem Repeats (STR) TTTTC = (TTTTC) 1 TTTTCTTTTCTTTTC = (TTTTC) 3 TTTTCTTTTCTTTTCTTTTCTTTTCTTTTC = (TTTTC) 5

Cataloging the world’s SNP variation

Gel electrophoresis Many cycles of PCR produce a large amount of the DNA fragment contained between the 2 primers. Add PCR primers. The PCR primers specifically recognize sequences on chromosome 2. Set of chromosomes 2 2 Figure 21.5 The two STS copies in this case are different in length. Therefore, their microsatellites have different numbers of CA repeats PCR of microsatellites

Figure Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 12345bp (b) Electrophoretic gel of PCR products for a polymorphic microsatellite found in the family in (a). (a) Pedigree Fragment length Parents Offspring Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

The likelihood of linkage between two RFLPs is determined by the lod (logarithm of the odds) score method – Computer programs analyze pooled data from a large number of pedigrees or crosses involving many RFLPs – They determine probabilities that are used to calculate the lod score lod score = log 10 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Probability of a certain degree of linkage Probability of independent assortment In human genetics, computer algorithms can be used to determine linkage

Figure 21.7 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display The numbers denote the order of the members of the contig AB AB F F GH CD C BC D D E EF I I I J J K K K L LM M NO P P P Q R QR Vector Clone individual pieces into vectors A collection of overlapping clones, known as a contig M Physical Mapping

Figure 21.8 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Genes A and B had been mapped previously to specific regions of chromosome 11 – Gene A was found in the insert of clone #2 – Gene B was found in the insert of clone #7 So Genes A and B can be used as genetic markers (i.e., reference points) to align the members of the contig mu Gene A Region of chromosome 11 Gene AGene B Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Selectable Marker gene TEL ORI (E.coli origin of replication) ORI CEN (yeast centromere) CEN Selectable marker gene Selectable marker gene Selectable marker gene TEL (yeast telomere) TEL Yeast artificial chromosome (YAC) Cut with EcoRI and BamHI. Left arm Mix and add DNA ligase. Note: This is not drawn to scale. The chromosomal DNA is much larger than the YAC vector. Chromosomal DNA Right arm Fragment not needed in yeast Cut (occasionally) with a low concentration of EcoRI to yield very large fragments. EcoRI site ARS (yeast origin of replication) ARSLarge piece of chromosomal DNA BamHI site BamHI site + + Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Figure 21.9 EcoRI is used at low concentrations so only some sites are digested Each arm has a different selectable marker. Therefore, it is possible to select for yeast cells with YACs that have both arms

lacZ HindIII BamHI SphI BAC vector parC parB parA oriS repE cm R Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Figure Chromosome million bp Low resolution (3–5 million bp) High resolution (1–100,000 bp) pq D16S85D16S60 D16S159 D16S48 D16S150D16S149 D16S160D16S40D16S times expansion 219 bp Cytogenetic map (resolution of in situ hybridization 3–5 megabases) Physical map of overlapping cosmid clones (resolution 5–10 kilobases) Sequence-tagged site (resolution 1 base) YAC N16Y1 150,000 bp STS N16Y1-10 Primer 3′ 5′ * * GATCAAGGCGTTACATGA 5′—GATCAAGGCGTTACATGA—3′ CTAGTTCCGCAATGTACT Cosmid contig C4 N16Y1-29 N16Y1-18 N16Y1-10 N16Y G11 312F1 5F3 N16Y1-30 N16Y1-16 N16Y1-12 N16Y1-14 N16Y1-13 = (GT) n Linkage map (resolution 3–5 cM; not all linkage markers are shown) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. D16AC6.5 3′ 5′ AGTCAAACGTTTCCGGCCTA 3′ TCAGTTTGCAAAGGCCGGAT AGTCAAACGTTTCCGGCCTA * *

12345 Numbers indicate regions that are subcloned. (Starting clone) Subclone. Cosmid vector Subclone. Screen a library. (Third clone) Repeat subcloning and screening until gene A is reached. (Second clone)....n Gene B Gene A Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display n Figure The number of steps required to reach the gene of interest depends on the distance between the start and end points

Figure Chromosomal DNA Chromosomal DNA BAC vector BAC contig Clones from one BAC insert: Vector Clone large chromosomal DNA fragments into BACs and create a contig for each chromosome. Shear DNA into small and large pieces. Clone chromosomal DNA pieces into vectors. For each BAC, shear into smaller pieces and clone DNA pieces into vectors. From the clones of each BAC, determine the chromosomal DNA sequence, usually at one end, by shotgun sequencing. The results below show the sequences from three chromosomal DNA clones. Based on overlapping regions, create one contiguous sequence. Chromosomal DNA (a) Hierarchical genome shotgun sequencing(b) Whole-genome shotgun sequencing CCGACCTTACCGACCA CTTACCCGACCGACCACCCGATTAATCGCGAATTG GACCACCCGATTAAT TTAATCGCGAATTG Determine the chromosomal DNA sequence, usually at both ends, by shotgun sequencing. The results below show sequences of three chromosomal DNA clones. Based on overlapping regions, create one contiguous sequence. TTACCGGTAGGCACCT GGTAGTTACCGCACCTGTTACGGGTCAAACCTAGG CACCTGTTACGGGTC GGGTCAAACCTAGG Isolate chromosomal DNA Isolate chromosomal DNA Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Emulsify the beads so there is only one bead per droplet. The droplets also contain PCR reagents that amplify the DNA. Deposit the beads into a picotiter plate. Only one bead can fit into each well. Add sequencing reagents: DNA polymerase, primers, ATP sulfurylase, luciferase, apyrase, adenosine 5′ phosphosulfate, and luciferin. Sequentially flow solutions containing A, T, G, or C into the wells. In the example below, T has been added to the wells. PPi (pyrophosphate) is released when T is incorporated into the growing strand. Isolate genomic DNA and break into fragments. Covalently attach oligonucleotide adaptors to the 5′ and 3′ ends of the DNA. Denature the DNA into single strands and attach to beads via the adaptors. Note: Only one DNA strand is attached to a bead. Fragment of genomic DNA Adaptors PPi+ Adenosine 5′ phosphosulfate ATP + luciferin ATP sulfurylase Light Light is detected by a camera in the sequencing machine. Luciferase Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. C A T G C A T T Primer