A b Fig. S1 Expression constructs for Cas9 without DsRed gene, and Cas9 mRNA level in pZD_Cas9 transformed calli. a pZH_Cas9 without the DsRed expression.

Slides:

Advertisements

Similar presentations

Table S1 (Ho et al.) Table S1 Primers and their sequences used in this study. Name Sequence CDPK1-F1 5-CTACAGATCTATGGGGAATCAGTGCCA-3' CDPK1-R15'-TCATAGATCTCTAAACTCCATTTTCACAGAT-3'

Advertisements

Target gene gRNA NameTarget sequence / PAM*Restriction Enzyme Young Seedling Albino (YSA)gYSAGCGCGCCACCTCGGCCGAAG / CGGSfiI Phytoene desaturase (PDS) gPDS-1†CGTCCAACCCATTCCTCTGC.

What did you learn from surfing FlyBase? Why do the inversions in Balancer chromosomes greatly reduce the frequency of crossing over in meiosis?

Recombinant DNA Technology. Restriction endonucleases - Blunt ends and Sticky ends.

Cell abnormalities Jamil Momand 1/31/12. Koch's postulates are: 1) The microorganism must be found in abundance in all organisms suffering from the disease,

Targeted Disruption of V600E-Mutant BRAF Gene by CRISPR-Cpf1

Rupp et al. Supplementary Figure 1: Structure of the human troponin T gene Exon 6 Genomic DNA cDNA from mRNA mutation Exon 9 Exon bp Parts of genomic.

Figure 1. AsCpf1 and LbCpf1-mediated gene editing in human cells

Volume 17, Issue 2, Pages (August 2015)

Figure S1. Analysis of the embryo edited using gRNA-2 and HF2-BE2

Molecular recordings by directed CRISPR spacer acquisition

Yuming Lu, Jian-Kang Zhu Molecular Plant

Dan Ding, Kaiyuan Chen, Yuedan Chen, Hong Li, Kabin Xie

CRISPR/Cas9-mediated genome editing of PML in human cell lines.

RNAi Related Mechanisms Affect Both Transcriptional and Posttranscriptional Transgene Silencing in Drosophila Manika Pal-Bhadra, Utpal Bhadra, James.

Mutations in the Liver Glycogen Phosphorylase Gene (PYGL) Underlying Glycogenosis Type VI (Hers Disease) Barbara Burwinkel, Henk D. Bakker, Eliezer Herschkovitz,

Volume 122, Issue 4, Pages (August 2005)

Strategy for CRISPR/Cas9-mediated genome editing in ΔEx50 mice

The Small RNA IstR Inhibits Synthesis of an SOS-Induced Toxic Peptide

Volume 13, Issue 1, Pages (July 2007)

Mutual Repression by Bantam miRNA and Capicua Links the EGFR/MAPK and Hippo Pathways in Growth Control Héctor Herranz, Xin Hong, Stephen M. Cohen Current.

Exon Circularization Requires Canonical Splice Signals

Mouse Genome Engineering via CRISPR-Cas9 for Study of Immune Function

Volume 55, Issue 2, Pages (July 2014)

Volume 154, Issue 6, Pages (September 2013)

Schematic representation of the lbk gene, positions of gRNAs, and knock-in cassette. Schematic representation of the lbk gene, positions of gRNAs, and.

Volume 7, Issue 1, Pages (April 2014)

Volume 13, Issue 2, Pages (October 2015)

Size Polymorphisms in the Human Ultrahigh Sulfur Hair Keratin-Associated Protein 4, KAP4, Gene Family Naoyuki Kariya, Yutaka Shimomura, Masaaki Ito

Volume 13, Issue 6, Pages (December 2013)

USH2A Gene Editing Using the CRISPR System

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

PM analysis of wild-type E. coli K-12 and its rpoZ-defective mutant.

Volume 17, Issue 2, Pages (August 2015)

Objective: Convert a hulled (covered) barley into a hull-less (Naked

Volume 22, Issue 3, Pages e3 (September 2017)

Andrew R. Bassett, Charlotte Tibbit, Chris P. Ponting, Ji-Long Liu

Volume 154, Issue 6, Pages (September 2013)

Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, Leonard I. Zon

Expression of a microRNA-Resistant Target Transgene Misrepresents the Functional Significance of the Endogenous microRNA: Target Gene Relationship Junyan.

RAD51 is essential for L. donovani.

Thijn R Brummelkamp, René Bernards, Reuven Agami Cancer Cell

Volume 12, Issue 9, Pages (September 2015)

Volume 9, Issue 4, Pages (October 2017)

Material for Quiz 5 from Chapter 8

Volume 23, Issue 3, Pages (March 2015)

Tagging of the endogenous Py03652 gene with the gfp gene in Plasmodium yoelii. Tagging of the endogenous Py03652 gene with the gfp gene in Plasmodium yoelii.

Volume 6, Issue 4, Pages (July 2013)

Inactivation of the Dp1 locus.

Fig. 4. Mutations induced by TALENs are heritable through the germline

Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, Leonard I. Zon

The sh339 and qmc554 alleles of gfi1b.

Fig. 4 Gene disruption via chip.

Fig. 6. F1 trβ mutants accomplish natural metamorphosis.

Multiplexed Mutagenesis Using the Csy4 System in Tomato Protoplasts.

Strategy for marker recycling through CRISPR-Cas9-induced marker excision. Strategy for marker recycling through CRISPR-Cas9-induced marker excision. Consider.

Identification and Characterization of a Mutation, in the Human UDP-Galactose-4- Epimerase Gene, Associated with Generalized Epimerase-Deficiency Galactosemia

miR-9 regulation of Pax6 expression.

Fig. 2 Cas9/RecA-mediated in vivo gene correction of Pde6b.

Cloning, Gene Structure, and Expression Patterns of Nap1 and Pir1 Genes.(A) SSAP detection of LORE-1 element integrations in pir1-1 and nap1-1 mutant plants.

Targeting DCLK1 by miRNA-137.

DICER1 Is Essential for Self-Renewal of Human Embryonic Stem Cells

Inactivation of human TRAC and CD52 genes by TALENs

Dysregulated NF-κB activation in Il1r8+/+/lpr and Il1r8−/−/lpr mice.

Fig. 2 Functional validation of the TaWAK gene by mutagenesis and transgenesis. Functional validation of the TaWAK gene by mutagenesis and transgenesis.

Genome-Edited Triple-Recessive Mutation Alters Seed Dormancy in Wheat

Potent and sequence-specific removal through genome targeting with CRISPR-Cas systems. Potent and sequence-specific removal through genome targeting with.

Comparison of Different Systems for Expressing Multiple gRNAs.

Knock-in of the rpl42-P56Q mutation using the split-ura4 system.

Fig. 3 Genome editing of the MSTN gene.

Presentation transcript:

a b Fig. S1 Expression constructs for Cas9 without DsRed gene, and Cas9 mRNA level in pZD_Cas9 transformed calli. a pZH_Cas9 without the DsRed expression cassette was used for the first transformation (TF 1 st ). pZK_gRNA targeted on the YSA locus was used for the second transformation (TF 2 nd ). b Cas9 mRNA levels normalized to the OsActin1 mRNA level are presented according to the ratio relative to line Cas9-#5. Data are the mean ±SD of three separate PCR analyses.

Fig. S2 Mutations detected in Cas9, gDsRed-3 double transformed calli at different time points. Representative sequences of mutant alleles identified from same transgenic line at 1 month and 2 months after pZK_gDsRed-3 transformation. The wild type sequence is shown at the top with the PAM sequence in green and the 20-nt target sequence in red. The blue arrowhead indicates the expected cleavage site. Dashes, deleted bases. The net change in length is noted to the right of each sequence (+, insertion; - deletion). The number of clones representing each mutant allele is shown in brackets. In 2-month- cultured cells after pZK_gDsRed-3 transformation, the 4 types of mutation shown at the top are the mutation patterns detected in cells cultured for 1 month. The five types of mutation at the bottom are the additional mutation patterns that were not detected at 1 month but that appeared in cells cultured for 2 months.

Fig. S3 Mutation frequency in pZH_Cas9 and pZK_gCDKB2 double transformed calli. CAPS analysis of the CDKB2 locus at different culture periods. Lines #1 - #6, independent pZK_gRNA targeted on CDKB2 locus (pZK_gCDKB2) transformed callus at 1 month and 2 months after pZK_gCDKB2 transformation. M, Marker; –RE, PCR product without restriction enzyme reaction; +RE, BsrGI-digested; -gRNA, pZH_Cas9 transformed calli without gRNA.

Target gene gRNA NameTarget sequence / PAM*Restriction Enzyme DsRedgDsRed-1GACCCAGGACTCCTCCCTGC / AGGPstI gDsRed-2GTGATGCAGAAGAAGACCAT / GGGNcoI gDsRed-3GTAGTAGCCGGGCAGCTGCA / CGGPvuII Young Seeding Albino (YSA) gYSAGCGCGCCACCTCGGCCGAAG / CGG†SfiI Cyclin-Dependent Kinase B2 (CDKB2) gCDKB2GACGTACGGGAAGGTGTACA / AGGBsrGI *Recognition sequences of restriction enzymes are underlined. † Target sequence used in Feng et al. (2013). Table S1 List of target genes and target sequences used in this study.

Table S2 Mutation frequency in pZH_Cas9 and pZK_gYSA double transformed calli at 1 month after pZK_gYSA transformation pZH_Cas9 transgenic line RCHMF(%) Mutation variations #15/1224-1,-2,+1(A),m1 #23/ ,+1(A,G) #34/233.2 #41/6N.D. #51/12N.D.

Table S3 Mutation frequency in pZH_Cas9 and pZK_gCDKB2 double transformed calli at different culture periods. gRNA Culture period after pZK2_gRNA transformation RCHMF 1 month2 months /1month 2months/ 1month RCHMF (%) Mutation variations RCHMF (%) Mutation variations gCDKB27/24N.D. 11/ ,-17,-37 +1(G,T), m <