GO based data analysis Iowa State Workshop 11 June 2009.

Slides:

Advertisements

Similar presentations

Molecular Biomedical Informatics Machine Learning and Bioinformatics Machine Learning & Bioinformatics 1.

Advertisements

MitoInteractome : Mitochondrial Protein Interactome Database Rohit Reja Korean Bioinformation Center, Daejeon, Korea.

Pathways analysis Iowa State Workshop 11 June 2009.

Modeling Functional Genomics Datasets CVM Lesson 3 13 June 2007Fiona McCarthy.

GO-based tools for functional modeling GO Workshop 3-6 August 2010.

Pathways & Networks analysis COST Functional Modeling Workshop April, Helsinki.

The STRING database Michael Kuhn EMBL Heidelberg.

STRING Modeling of biological systems through cross-species data integration.

Threshold selection in gene coexpression networks using spectral graph theory techniques Andy D Perkins*,Michael A Langston BMC Bioinformatics 1.

27803::Systems Biology1CBS, Department of Systems Biology Schedule for the Afternoon 13:00 – 13:30ChIP-chip lecture 13:30 – 14:30Exercise 14:30 – 14:45Break.

Gene Co-expression Network Analysis BMI 730 Kun Huang Department of Biomedical Informatics Ohio State University.

COG and GO tutorial.

Biological networks Tutorial 12. Protein-Protein interactions –STRING Protein and genetic interactions –BioGRID Signaling pathways –SPIKE Network visualization.

1 Protein-Protein Interaction Networks MSC Seminar in Computational Biology

Modeling Functional Genomics Datasets CVM Lesson 1 13 June 2007Bindu Nanduri.

Introduction to molecular networks Sushmita Roy BMI/CS 576 Nov 6 th, 2014.

Pathway Informatics 6 th July, 2015 Ansuman Chattopadhyay, PhD Head, Molecular Biology Information Services Health Sciences Library System University of.

GO Enrichment analysis COST Functional Modeling Workshop April, Helsinki.

Pathways Database System: An Integrated System For Biological Pathways L. Krishnamurthy, J. Nadeau, G. Ozsoyoglu, M. Ozsoyoglu, G. Schaeffer, M. Tasan.

DEMO CSE fall. What is GeneMANIA GeneMANIA finds other genes that are related to a set of input genes, using a very large set of functional.

Modeling Functional Genomics Datasets CVM Lessons 4&5 10 July 2007Bindu Nanduri.

341: Introduction to Bioinformatics Dr. Natasa Przulj Deaprtment of Computing Imperial College London

Protein-protein interactions Chapter 12. Stable complex Transient Interaction Transient Signaling Complex Rap1A – cRaf1 Interface 1310 Å 2 Stable complex:

Ch10. Intermolecular Interactions and Biological Pathways

Cytoscape A powerful bioinformatic tool Mathieu Michaud

Review of Ondex Bernice Rogowitz G2P Visualization and Visual Analytics Team March 18, 2010.

Viewing & Getting GO COST Functional Modeling Workshop April, Helsinki.

Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.

MATISSE - Modular Analysis for Topology of Interactions and Similarity SEts Igor Ulitsky and Ron Shamir Identification.

PutidaNET :Interactome database service and network analysis of Pseudomonas putida KT2440 (P. putida KT2440) Korean BioInformation Center (KOBIC) Seong-Jin,

Overview  Introduction  Biological network data  Text mining  Gene Ontology  Expression data basics  Expression, text mining, and GO  Modules and.

Network Analysis and Application Yao Fu

Hyun Seok Kim, Ph.D. Assistant Professor, Severance Biomedical Research Institute, Yonsei University College of Medicine Lecture 13. Network Analysis MES

Modeling Functional Genomics Datasets CVM Lesson 6 11 July 2007Bindu Nanduri.

Biological Pathways & Networks

Bioinformatics Dr. Víctor Treviño BT4007

Networks and Interactions Boo Virk v1.0.

Intralab Workshop - Reactome CMAP Chang-Feng Quo June 29 th, 2006.

Managing Data Modeling GO Workshop 3-6 August 2010.

HUMAN-MOUSE CONSERVED COEXPRESSION NETWORKS PREDICT CANDIDATE DISEASE GENES Ala U., Piro R., Grassi E., Damasco C., Silengo L., Brunner H., Provero P.

EADGENE and SABRE Post-Analyses Workshop 12-14th November 2008, Lelystad, Netherlands 1 François Moreews SIGENAE, INRA, Rennes Cytoscape.

Network & Systems Modeling 29 June 2009 NCSU GO Workshop.

Strategies for functional modeling TAMU GO Workshop 17 May 2010.

GO-based tools for functional modeling TAMU GO Workshop 17 May 2010.

From Functional Genomics to Physiological Model: Using the Gene Ontology Fiona McCarthy, Shane Burgess, Susan Bridges The AgBase Databases, Institute of.

Workshop Aims NMSU GO Workshop 20 May Aims of this Workshop  WIIFM? modeling examples background information about GO modeling  Strategies for.

Introduction to the GO: a user’s guide Iowa State Workshop 11 June 2009.

Getting Started: a user’s guide to the GO GO Workshop 3-6 August 2010.

Getting Started: a user’s guide to the GO TAMU GO Workshop 17 May 2010.

PPI team Progress Report PPI team, IDB Lab. Sangwon Yoo, Hoyoung Jeong, Taewhi Lee Mar 2006.

EB3233 Bioinformatics Introduction to Bioinformatics.

9/10/06 GO Users Meeting 2006 Seattle, Washington The AgBase GO Annotation Tools Susan Bridges 1,3, Fiona McCarthy 2,3, Nan Wang 1,3, G. Bryce Magee 1,3,

Introduction to biological molecular networks

Getting GO: how to get GO for functional modeling Iowa State Workshop 11 June 2009.

Discovering functional interaction patterns in Protein-Protein Interactions Networks   Authors: Mehmet E Turnalp Tolga Can Presented By: Sandeep Kumar.

 Signal Transduction transmits signals from outside to the inside of the cell  Integer Linear Programming model is used to unravel STN.

Predicting Protein Function Annotation using Protein- Protein Interaction Networks By Tamar Eldad Advisor: Dr. Yanay Ofran Computational Biology.

High throughput biology data management and data intensive computing drivers George Michaels.

 What is MSA (Multiple Sequence Alignment)? What is it good for? How do I use it?  Software and algorithms The programs How they work? Which to use?

Pathway Informatics 30 th March, 2016 Ansuman Chattopadhyay, PhD Head, Molecular Biology Information Services Health Sciences Library System University.

Lecture 4.31 Protein Pathways and Pathway Databases Shan Sundararaj University of Alberta Edmonton, AB

CSCI2950-C Lecture 12 Networks

1. SELECTION OF THE KEY GENE SET 2. BIOLOGICAL NETWORK SELECTION

Biological Databases By: Komal Arora.

Strategies for functional modeling

Interrogation of cross talk between proteins and gene regulatory networks in breast cancer Chambers, Teressa Lee Hiren Karathia Sridhar Hannenhalli.

Workshop Aims TAMU GO Workshop 17 May 2010.

Workshop Aims GO Workshop 3-6 August 2010.

Functional Annotation of the Horse Genome

Network biology An introduction to STRING and Cytoscape

Presentation transcript:

GO based data analysis Iowa State Workshop 11 June 2009

All tools and materials from this workshop are available online at the AgBase database Educational Resources link. For continuing support and assistance please contact: This workshop is supported by USDA CSREES grant number MISV

AgBase protein annotation process Protein identifiers or Fasta format GORetriever Annotated Proteins GOanna Proteins with no annotations GOSlimViewer

Hypothesis generating Gene Ontology enrichment analysis GO terms that are statistically (Fisher’s exact test) over or underrepresented in a set of genes Annotation Clustering group similar annotations based on the hypothesis that they should have similar gene members

Some resources DAVID: GOStat: EasyGO: AmiGO (does not use IEA) Onto-Express & OE2GO GOEAST Comparison of enrichment analysis tools : Nucleic Acids Research, 2009, Vol. 37, No. 1 1–13 (Tool_Comparison_09.pdf) DAVID and EasyGO analysis included DAVID&EasyGo.ppt

Database for Annotation, Visualization and Integrated Discovery

Onto-Express analysis instructions are Available in onto-express.ppt

Species represented in Onto-Express

For uploading your own annotations use OE2GO

Comparison Onto-Express, EasyGO, GOstat and DAVID Test set: 60 randomly selected chicken genes Used AgBase GO annotations as baseline annotations Vandenberg et al (BMC Bioinformatics, in review)

Networks & Pathways Iowa State Workshop 11 June 2009

Multiple data analysis platforms Proteomics Transcriptomics ESTs LIST

Our original aim…. …understand biological phenomena…. Bits and pieces of information Do not have the full picture How do we get back to BIOLOGY in this digital information landscape?

What do we know about biological systems …. biological systems are dynamic, not static how molecules interact is key to understanding complex systems Francis Crick, 1958

Types of interactions protein (enzyme) – metabolite (ligand) metabolic pathways protein – protein cell signaling pathways, protein complexes protein – gene genetic networks

Sod1 Mus musculus STRING Database string.embl.de /

PLoS Computational Biology March 2007, Volume 3 e42 Database/URL/FTP DIP BIND MPact/MIPS STRING MINT IntAct BioGRID HPRD ProtCom 3did, Interprets Pibase, Modbase CBM ftp://ftp.ncbi.nlm.nih.gov/pub/cbmftp://ftp.ncbi.nlm.nih.gov/pub/cbm SCOPPI iPfam InterDom DIMA Prolinks Predictomehttp://predictome.bu.edu/

Pathways & Networks A network is a collection of interactions Pathways are a subset of networks Network of interacting proteins that carry out biological functions such as metabolism and signal transduction All pathways are networks of interactions NOT ALL NETWORKS ARE PATHWAYS

Biological Networks Networks often represented as graphs Nodes represent proteins or genes that code for proteins Edges represent the functional links between nodes (ex regulation) Small changes in graph’s topology/architecture can result in the emergence of novel properties

Yeast Protein-Protein Interaction Map Nature 411, 2001, H. Jeong, et al

KEGG BioCyc Reactome GenMAPP BioCarta Pathguide – the pathway resource list Some resources

Gallus gallus is missing Pathguide Statistics

Reactome

What is feasible with my specific dataset?

Systems Biology Workflow Nanduri & McCarthy CAB reviews, 2008

Systems Biology Workflow For a given species of interest what type of data is available???

Retrieval of interaction datasets Evaluate PPI resources such as Predictome Prolinks for existence of species of interest If unavailable, find orthologous proteins in related species that have interactions!

I have interactions what next? Evaluate the quality of interactions i.e. type of method used for identification….what exactly are these methods?

I have interactions what next? Evaluate the quality of interactions i.e. type of method used for identification….what exactly are these methods? STRING Database

PPI Identification Experimental Computational Gene Coexpression TAP assays Sequence coevolution Yeast two hybrid Phylogenetic profile Gene Cluster Rosetta stone method Text mining TAP assays Yeast two hybrid (Y2H) Protein arrays PLoS Computational Biology March 2007, Volume 3 e42

PPI database comparisons Proteins: Structure, Function and Bioinformatics 63:

I have interactions what next? Evaluate the quality of interactions i.e. type of method used for identification….what exactly are these methods? Visualize these interactions as a network and analyze… what are the available tools?