Workpackage 2: Breeding Systems

Slides:

Advertisements

Similar presentations

Problem Results: Question: 1. You screen two libraries- cDNA; genomic

Advertisements

ZINC BIOFORTIFICATION OF CASSAVA TUBERS Shuaibu Kahya,Narayanan N. Narayanan 1, Eliana Gaitan- solis, Martin Fregene¹ and Richard T. Sayre 1 1 Donald Danforth.

Lecture 18, Chapter 11 Analysis of transgenic plants part I

SEXUAL HYBRIDIZATION SANITARY ASPECTS GENETIC TRANSFORMATION EMBRYOGENESIS GENETIC CHARACTERISATION G&H WP2 BREEDING SYSTEMS.

Recombinant DNA Technology

Disease Resistant Transgenic Grapevine Constitutively Expresses Vitis vinifera Thaumatin-like Protein SA Dhekney, ZT Li, MM Van Aman, M Dutt, J Tattersall,

Cloning Promoters Kelli Henry April 27, 2009.

BCM208 Metabolic Biochemistry Topic 7: Gene metabolism and Expression.

Sanitary status Flavour components analysis Flowering fertility assessment Genetic Resources Sexual system - developmental physiology - florogenesis -

What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.

Chapter 4: recombinant DNA

The MYB and BHLH Transcription Factor Families by Elaine Chiu.

Agarose Gel Electrophoresis and Southern Transfer.

Cloning:Recombinant DNA

Lab report structure I.Title II.Abstract III.Introduction IV.Methods and Materials V.Results VI.Discussion VII.References VIII.Figures.

Southern Transfer. Research Plan Isolate Genomic DNA Digest Genomic DNA with Various Restriction Enzymes Agarose Gel Electrophoresis and Southern Transfer.

Gene Regulation: What it is, and how to detect it By Jordan, Jennifer, and Brian.

Molecular Cloning: Construction of a recombinant DNA

Katie Surckla.  hGM-CSF stands for human Granulocyte- Macrophage Colony Stimulating Factor  hGM-CSF is a cytokine which regulates the production and.

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

Lecture 19, Chapter 11 Analysis of transgenic plants part II Neal Stewart.

Methods for Gene Activity Analysis By Auni Hovanesian Krista Templeton.

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

Recombinant DNA Technology Site directed mutagenesis Genetics vs. Reverse Genetics Gene expression in bacteria and viruses Gene expression in yeast Genetic.

Chapter 13 - Biotechnology

Application in Molecular Cloning David Shiuan Department of Life Science, Institute of Biotechnology and Interdisciplinary Program of Bioinformatics National.

Chapter 20~DNA Technology & Genomics. Who am I? Recombinant DNA n Def: DNA in which genes from 2 different sources are linked n Genetic engineering:

Trends in Biotechnology

-The methods section of the course covers chapters 21 and 22, not chapters 20 and 21 -Paper discussion on Tuesday - assignment due at the start of class.

Cloning and genetic engineering by Ivo Frébort. Cloning Clone: a collection of molecules or cells, all identical to an original molecule or cell To "clone.

Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal.

Molecular analysis of flavour biosynthesis in garlic Angela Tregova Jill Hughes, Jonothan Milne, Hamish Collin, Meriel Jones, Rick Cosstick, Brian Tomsett.

Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Hamish Collin, Meriel Jones, Brian Tomsett, Jill Hughes

By by Enkhchimeg Vanjildorj Supervisor Prof. Lee, Hyo-Yeon College of Applied Life Sciences, Cheju National University, Jeju , Korea College of.

1 Wei-Ying Chien National Tainan Teachers College Department of Natural Sciences Education 紅豆組織培養暨基因轉殖研究.

Differential Accumulation Pattern of Met-rich  -zein in Medicago sativa and Medicago truncatula Serina Padilla Dr. Champa Sengupta-Gopalan, Mentor Department.

Greenhouse Screening and Field Testing of Transgenic Grapevine for Fungal Resistance SA Dhekney 1, ZT Li 1, M Dutt 2, TW Zimmerman 3 and DJ Gray 4 1 Mid.

LOGO A novel WRKY transcriptional factor from Thlaspi caerulescens negatively regulates the osmotic stress tolerance of transgenic tobacco Plant Cell Rep.

Recombinant DNA What is the basis of recombinant DNA technology? How does one “clone” a gene? How are genetically modified organisms (GMOs) created? Illustration.

Molecular Biology II Lecture 1 OrR. Restriction Endonuclease (sticky end)

Chapter 10 Gene Isolation and Manipulation

Fig. S1 Quantitative and semi-quantitative RT-PCR analyses confirms the down regulation of SGT1, SKP1, RAR1, RBX1 and CUL1c gene transcripts.

Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Genetic Engineering. Clip clips.

Molecular Tools. Recombinant DNA Restriction enzymes Vectors Ligase and other enzymes.

Suppl. figure 1 Zale et al. 215E 223D 211E218E230E 36E 209F 23E 208F 236E212E213E 203D 210E 221D 207E WRI OLE DGA GAPDH 5E 100D 6B 25B 32D 206E205E 21E.

Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.

Genome Analysis Assaad text book slides only Lectures by F. Assaad can be downlaoded from muenchen.de/~farhah/index.htm.

Bacterial Transformation Green Fluorescent Protein.

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.

The Flavr Savr Tomato.

DNA Technology and Genomics

Supplemental Figure 1 A) B) C)

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

UNIT VII – GENOMICS & CANCER

Figure S3 Gui kb a TP b Figure S3 Southern hybridization analysis of hygromycin.

Lecture 12 Analysis of transgenic plants

Vav‐1 gene‐targeting strategy.

Genetic Transformation of Plants: Methods and Approaches to

Recombinant DNA Technology

NILV‐S/MAR‐mediated transgene expression

APOE Gene Targeting (A) Schematic representation of the endogenous APOE locus, the gene targeting vector and the targeted APOE locus. The exons of the.

NILV‐S/MAR‐mediated transgene expression

Establishment of monoclonal SMN2-GFP reporter line in HEK293.

PCR amplification of the ORF encoding the cytosolic p36 protein of M

Disruption of the svkA gene encoding severin kinase.

Volume 2, Issue 4, Pages (July 2009)

Presentation transcript:

Workpackage 2: Breeding Systems Specific objectives transformation research Development of a reliable transformation protocol for garlic using Agrobacterium tumefaciens as a vector The production of transgenic garlic with an altered S metabolism Persons involved Si-Jun Zheng, Betty Henken, Frans Krens, Chris Kik (Plant RI, Wageningen, the Netherlands)

Short overview of research 2002-2003 In vitro: callus induction and plant regeneration on non-apical parts of roots. Genetic transformation: two transformation systems via GUS and GFP; molecular analysis on transgenic plants. Genetic modification of sulphur metabolism: gene isolation and fusion, transform APS1 gene into garlic.

Development of garlic regeneration system (Zheng et al., 2003. In Vitro Cell. Dev. Biol. Plant 39: 288-292)

Development of a garlic genetic transformation system GUS transformation system destructive GFP transformation system non-destructive

Genetic transformation: analysis of transgenic garlic via GUS

Genetic transformation: analysis of transgenic garlic via GFP Garlic plants with GFP expression after selection for 4 months and regeneration for another 3 months (cv. Printanor)

Analysis of transgenic garlic: standard PCR uid A primers resulting in a 710 bp fragment lane 1-3: transgenic garlic lane 4: negative control lane 5: positive control lane 6: 1kb DNA ladder marker 1 2 3 4 5 6

Genomic DNA blot : 802 bp fragment of Cry1Ca PCR product as a probe N 1 2 3 4 M 5 6 7 8 M 9 10 111213 lane 1-13: individual transgenic garlic plant transformed with with pCAMBIA1301- Cry1Ca lane M:  DNA digested with Hind III lane N: untransformed garlic DNA as negative control

Genetic transformation: overview

Genetic modification of S metabolism

ATP sulfurylase isolated from Arabidopsis thaliana and Allium cepa (shallot) cDNA fragment generated from RT-PCR

Fusion constructs used for garlic transformation Arabidopsis APS1-GFP GFP-APS1 Shallot SAPS-GFP GFP-SAPS

ATP sulfurylase (APS1) fused with GFP Lane 1: N-terminus fusion fragment APS1-GFP Lane 2-3: C-terminal fusion fragment GFP-APS1 M: 1kb DNA ladder marker M 1 2 3

Stable expression of fusion protein in garlic leaf APS1-GFP GFP GFP-APS1

Transgenic shoot with APS1-GFP fusion protein

Next steps in transformation research Finalising manuscript on garlic transformation (for Molecular Breeding) Molecular and functional analysis of transgenic plants with APS1 gene (if there is enough time)