Why do Cells Divide? Why do Cells Divide? Cell Size Limits

Animal & Plant Cells

DNA Replication 1.Replication (DNA  DNA)

DNA Replication  Replication = DNA copies itself exactly (Occurs within the nucleus) (Occurs within the nucleus)  Any mistake in copying = mutation  DNA mutation = chromosomal mutation

A. Basic Facts of DNA Replication 1. Complementary base pairing makes replication possible C - G A - T

A. Basic Facts of DNA Replication 2. One side of DNA molecule is a template template for formaking the the other side (strand) other side (strand)

A. DNA Replication-occurs during “S” phase of interphase 1.Occurs in the nucleus prior to any cell division 2.Enzyme is used to “unzip” or “unwind” the DNA a.Forms a bubble at the origin site

B. Process of DNA Replication 1.Uncoil (topoisomerase & unzip DNA molecule  Enzyme (-ase) breaks weak Hydrogen Bonds between bases

B. Process of DNA Replication 2. Enzyme brings in complementary N-bases DNA Polymerase

B. Process of DNA Replication 3. Insert N-bases 4. Seal bonds with ligase

Replication Moovie C - G A - T

C. Semi-conservative replication 1.Each new DNA molecule contains contains one old strand & one new strand one new strand

DNA replication- replication bubbles

DNA replication- leading/lagging strands

DNA replication

DNA Replication (cont.) 3.Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA a.Nitrogenous bases pair up 1.A – T 2.C - G 4.As a result, you create two identical strands of DNA

Let’s Practice  Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTCTAGCCGATAATCCGTATAGGCTGCCAG

Why do cells divide? A. If they get too big  Surface area to volume ratio, etc.  Diffusion is fast over short distances but slow over long distances  So, b/c of slow rate of diffusion, cells can’t be giants b/c they would starve to death or be poisoned from the build up of wastes!!  When you increase the size of the cell, the vol. increases faster than the surface area of the cell membrane!!

Why do cells divide? B. Growth of organism  In order for an organism to grow, it needs more cells C. Repair  New cells replace old/damaged ones D. Reproduction  ASEXUAL- offspring is identical to parent  SEXUAL- offspring is a combo of both parents

Cell Division  Mitosis  Occurs in somatic cells (body cells)  Daughter cells are exactly like parent  Diploid  2n  In humans n=23 Meiosis –Produces gametes (germ cells/sex cells) –Daughter cells have half the chromo- somes as parent “Reduction division” –Haploid 1nWhy?

Mitosis- divides somatic cells to get tissues and organs built; makes individual grow into an adult

DNA VOCAB 1.Chromatin-  when a cell is not dividing it’s DNA is a tangled mass of thin threads. 2.Chromosome-  When the DNA is ready to divide it condenses into individual chromosomes  In humans- there are 23 HOMOLOGOUS PAIRS of chromosomes  The two chromosomes in a pair are SIMILAR but not exactly alike  One is from mom and one from dad 3.Sister Chromatid-  When the DNA replicates (to make one copy for each cell) the two copies join together by a centromere and each copy is called a SISTER CHROMATID  These sisters are EXACTLY ALIKE!

Chromatin to Chromosomes

TYPICAL HOMOLOGOUS CHROMOSOME PAIR

Before & After DNA replication (“S” phase)

The Cell Cycle (Somatic Cells) A.INTERPHASE: growth and preparation 1.G1 2.S 3.G2 B.MITOSIS: Nucleus divides 1.Prophase 2.Metaphase 3.Anaphase 4.Telophase C.CYTOKINESIS: Division of cytoplasm

Reminder from cell theory  All cells come from pre-existing cells!! -Cell Division follows this b/c it’s the process where new cells are made from 1 cell -Cell Division follows this b/c it’s the process where new cells are made from 1 cell  Cell Division makes 2 new daughter cells that are identical to the parent cell

Cell Cycle- The life of a cell

Cell Cycle- Interphase Interphase (Nucleus enclosed in nuclear membrane, nucleolus present, chromosomes appear as chromatin (in other words, chromosomes are not yet visible)) Interphase (Nucleus enclosed in nuclear membrane, nucleolus present, chromosomes appear as chromatin (in other words, chromosomes are not yet visible))  a) G1 phase- intense cellular activity and growth; organelles activity and growth; organelles double double  b) S phase- DNA synthesis- chromosomes replicate chromosomes replicate (copy) (copy)

Chromatin to Chromosomes

Interphase continued  c) G2 phase- spindle fibers are assembled/ centrioles assembled/ centrioles replicate replicate - cell prepares for cell division - cell prepares for cell division

Interphase Diagram

MITOSIS PHASES

Prophase (1 st stage) Prophase- 1st stage of actual cell division Prophase- 1st stage of actual cell division  a.) Chromosomes condense and shorten, become distinguishable become distinguishable b.) Chromatids attached near center by centromere centromere  c.) Centrioles separate, migrate to the poles  d.) Spindle fibers form between centrioles, asters form asters form  e.) Nuclear membrane disintegrates, nucleolus disappears (in order to nucleolus disappears (in order to separate contents of nucleus, it must separate contents of nucleus, it must disappear ) disappear )

Prophase Early prophase Late prophase

Metaphase- 2 nd stage (shortest)  a.) chromosomes line up in pairs at equator (center of cell) at equator (center of cell)  b.) centromere of each chromosome is attached to a chromosome is attached to a separate spindle fiber separate spindle fiber

Metaphase diagram Metaphase

Anaphase- 3 rd stage  a.) Centromere of each chromosome separates separates  b.) Separation of the chromatids in each pair pair  c.) Spindle fibers appear to shorten, pulling the chromatids apart at the pulling the chromatids apart at the centromere (now called centromere (now called chromosomes) chromosomes)  d.) migration of the chromosomes ends with the arrival at the poles and the with the arrival at the poles and the formation of clusters formation of clusters

Anaphase diagram Anaphase

Telophase – 4 th stage  a.) Cleavage furrow forms b/w 2 cells and spindle fibers disappear and spindle fibers disappear  b.) Nuclear membrane forms around each set of chromosomes (forms 2 each set of chromosomes (forms 2 new nuclei) new nuclei)  c.) Chromosomes uncoil to form chromatin net (getting ready for chromatin net (getting ready for interphase) interphase)  d.) Nucleoli reorganized

Telophase Diagram Telophase

Cytokinesis  Cytokinesis- division of the cytoplasm  In animal cells- cell membrane pinches together, furrow forms along the equator.  -In plant cells- cell plate forms in the middle of the dividing cell middle of the dividing cell