Trumpet leaves and microRNA Catherine Kidner CSHL.

Slides:

Advertisements

Similar presentations

Shoot Development A. Function and organization of the apical meristem

Advertisements

Lectures in Plant Developmental Physiology, 3 cr. Kurt Fagerstedt Department of Biological and Environmental Sciences Plant Biology Viikki Biocenter 3.

Flowering Plants Flowering plants (angiosperms) have two growth phases – vegetative growth, production of stems and leaves, occurs at the apical meristem,

Meristem organization

1.Generate mutants by mutagenesis of seeds Use a genetic background with lots of known polymorphisms compared to other genotypes. Availability of polymorphic.

Distinct Roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA Silencing Pathways Lee, S.Y., Nakahara, K., Phan, J.W., Kim, K., He, Z., Sontheimer,

Advantages of C. elegans: 1. rapid life cycle 2. hermaphrodite

Shoot meristem self-organization and identity

Cells and cell growth Cell walls and membranes Fertilization, embryogenesis vegetative development.

Cell expansion plays a major role in growth Root cells expand their volume 50 times by expanding lengthwise but not widthwise.

Origins of Multicellularity

Young Leaf Shoot Tip Axillary Bud Node Internode.

Presenting: Asher Malka Supervisor: Prof. Hermona Soreq.

Importance of microRNA for seedling development in Arabidopsis thaliana Jennifer Coppersmith Department of Biochemistry and Biophysics Mentor: Dr. Hiro.

Chapter 15 Noncoding RNAs. You Must Know The role of noncoding RNAs in control of cellular functions.

More regulating gene expression. Fig 16.1 Gene Expression is controlled at all of these steps: DNA packaging Transcription RNA processing and transport.

Gene Regulation results in differential Gene Expression, leading to cell Specialization Eukaryotic DNA.

Young Leaf Shoot Tip Axillary Bud Node Internode.

Ethylene responses Developmental processes

MBP1007/ Nucleic Acids A functional mRNA: The cytoplasmic story Objectives (1) To discuss the iNUTS and iBOLTS of how mRNAs function in the cytoplasm.

rasiRNAs: a class of small regulatory RNAs

Changes to Syllabus: Quizzes put back: Change Oct. 3 to Oct. 17

Epigenetics: RNAi and Heterochromatin formation

Drosha. 121th Lab meeting 석사 2 년 박 은 실.

Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem.

Mahmuda Khan. Goal  To obtain training data – sentences from the literature – to validate patterns involving triplets of Arabidopsis thaliana genes,

Arabidopsis thaliana Response to Tobacco Rattle Virus Jessica Martin, Cory Zoetewey, and Lisa K. Johansen, Department of Biology University of Colorado.

The Genetic Basis of Development

Characterization of RDR Gene Expression Johnny R. Nunez and Lisa K. Johansen Community College of Denver and University of Colorado at Denver and Health.

Human Drosophila C. elegans ~ 24,000 Genes ~ 13,000 Genes ~ 19,000 Genes Mouse ~ 24,000 Genes.

Advantages of C. elegans: 1. rapid life cycle 2. hermaphrodite 3. prolific reproduction 4. transparent 5. only ~1000 cells 6. laser ablation 7. complete.

RNA-ligand interactions and control of gene expression

Atta ur Rahman school of biological Science National University of Sciences & Technology CMB-234:Molecular Biology.

Ch 16. Posttranscriptional Regulation RNA interference (RNAi)

Homework #2 is due 10/17 Bonus #1 is due 10/24 Office hours: M 10/ :30am 2-5pm in Bio 6.

Lateral organs.

MicroRNAs in plant development some miRNA families are conserved in moss, indicating their very ancient origin. These include miR-156, miR-160, miR-319,

M2/25EXAM 1Chapters 1, 3, 4, and pp W2/27Ch. 2More molecular development of Drosophila M3/3CLASS MEETS IN THE LIBRARY, Room 518 of the Glickman.

Testing the ABC floral-organ identity model: expression of A and C function genes Objectives: To test the validity of the ABC model for floral organ identity.

defined concept of homologous organs

Map-based cloning of interesting genes

Volume 6, Issue 4, Pages (October 2000)

John F. Golz, Emma J. Keck, Andrew Hudson Current Biology

Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis

Yuval Eshed, Stuart F Baum, John L Bowman Cell

MicroRNAs: regulators of gene expression and cell differentiation

Establishment of polarity in lateral organs of plants

Volume 10, Issue 11, Pages (March 2015)

Volume 93, Issue 7, Pages (June 1998)

Volume 13, Issue 1, Pages (July 2007)

Establishment of polarity in lateral organs of plants

John F. Golz, Emma J. Keck, Andrew Hudson Current Biology

WEREWOLF, a MYB-Related Protein in Arabidopsis, Is a Position-Dependent Regulator of Epidermal Cell Patterning Myeong Min Lee, John Schiefelbein Cell

Noncoding RNA roles in Gene Expression

AGO1 Homeostasis Entails Coexpression of MIR168 and AGO1 and Preferential Stabilization of miR168 by AGO1 Hervé Vaucheret, Allison C. Mallory, David.

Volume 116, Issue 2, Pages (January 2004)

Competence to Respond to Floral Inductive Signals Requires the Homeobox Genes PENNYWISE and POUND-FOOLISH Harley M.S Smith, Bruce C Campbell, Sarah Hake

Volume 19, Issue 17, Pages (September 2009)

The PHANTASTICA Gene Encodes a MYB Transcription Factor Involved in Growth and Dorsoventrality of Lateral Organs in Antirrhinum Richard Waites, Harinee.

Volume 7, Issue 2, Pages (August 2004)

Prediction of Plant MicroRNA Targets

Volume 13, Issue 20, Pages (October 2003)

Volume 133, Issue 1, Pages (April 2008)

Volume 16, Issue 9, Pages (May 2006)

MicroRNA Binding Sites in Arabidopsis Class III HD-ZIP mRNAs Are Required for Methylation of the Template Chromosome Ning Bao, Khar-Wai Lye, M.Kathryn.

Damien Garcia, Sarah A. Collier, Mary E. Byrne, Robert A. Martienssen

Doris Wagner, Elliot M. Meyerowitz Current Biology

Arabidopsis RPA2: A Genetic Link among Transcriptional Gene Silencing, DNA Repair, and DNA Replication Taline Elmayan, Florence Proux, Hervé Vaucheret

Regulation of the SQUAMOSA PROMOTER-BINDING PROTEIN-LIKE genes/microRNA156 Module by the Homeodomain Proteins PENNYWISE and POUND- FOOLISH in Arabidopsis

Wang Long , Mai Yan-Xia , Zhang Yan-Chun , Luo Qian , Yang Hong-Quan

Presentation transcript:

Trumpet leaves and microRNA Catherine Kidner CSHL

Patterning events happen very early in leaf development

Processes in leaf development Down regulation of meristem-specific genes Growth and cell differentiation Establishment of axis

Stages of leaf development

rosette leaf cauline leaf Arabidopsis thaliana flower silque (fruit) lateral shoot 5 Chromosomes 125 Mega bases of DNA First plant genome sequenced (2001)

Patterning events happen very early in leaf development Trichome (hair) Interlocking epidermis Petiole Leaf blade expanding

Genes involved in leaf development YABBY (FIL) KANADI PHB STM AS1

Relative size Mutations in ARGONAUTE1 Cause Developmental Defects Stem cell defects Organ identity defects Organ polarity defects

Mapping Mutations in Arabidopsis

Populations of Arabidopsis

LandsbergColumbia Most ‘classical’ mutants Easiest to transform originally Compact, so easy to work with Most new insertion lines Easiest to transform now Full genome sequence Two lab strains

CAPs markers exploit the variation between the two strains catcgtcggggagttagatgtatatatatcgctgt catcgtcggggacttagatgtatatatatcgctgt Ler Col-0 Dde1 cttag

CAPS mapping ago-12/ago1-12+/+ Self F1 F2 Plants

ago-12 phenotype Wild type siblings L/L C/L C/C

The Role of ARGONAUTE

The ARGONAUTE family RG-richPAZPIWI RG-rich PAZ PIWI AGO family Piwi family

ago1-9 ago1-10 Strong ago1-12 Medium ago1-11 Weak An Allelic Series of ARGONAUTE1 Mutants RG-richPAZPIWI RG-richPAZPIWI

dsRNA siRNA RISC AGO aaaa Centromere function Viral defense PTGS Development RNA interference Science 2002

miRNA and the Role of AGO1 CAF AGO1 22nt miRNA AGO1 aaaaaaa mRNA miRNA precursor aaaaaaa mRNA degradation RISC

AGO1 and Development

Genes regulated by AGO1 One Step RT-PCR WT ago1-10 WT ago1-10 WT ago1-10 WT ago ng10ng1ng0.1ng AS1 ER AG CLF FIL KAN1 AP1 No Change Up in ago Down in ago No Change Down in ago No Change Total RNA

AGO1 is required for stem cell function ago1-11 ago1-11/ stm-2 Weak alleles of STM enhance weak alleles of AGO1 Strong alleles of AGO1 lack shoot apical meristems ago1-10

AGO1 is required for organ identity via UFO and LFY

ago1-12

ago1 has Adaxialised Organs FIL WT ago WT ago ER 100ng10ng1ng0.1ng ET2689 ET3964

caf-1 (weak) ago1-11 (weak) caf/caf, ago1-11/ago1-11 Strong caf alleles are embryo lethal miRNA Regulation is Required for Stem Cells and Polarity

The HD-ZIP III gene PHABULOSA is Associated with Adaxial Cell Fate WT Phab1-D/+ McConnell et al., 1999, 2001

homeodomain START lipid-sterol binding domain leucine zipper At REVOLUTA3’ GGCCTGGTCCGAAGTAGG 5’ At PHABULOSA 3’ GGCCTGGTCCGAAGTAGG 5’ At PHAVOLUTA 3’ GGCCTGGTCCGAAGTAGG 5’ At miRNA1655’ CCGGACCAGGCTTCATCC 3’ At miRNA1665’ CCGGACCAGGCTTCATCC 3’ HD-ZIP III Genes are Targets of miRNA 1kb Reinhard et al., Llave et al., Parks et al., 2002 *

PHABULOSA PHAVOLUTA REVOLUTA TUBULIN RUBISCO ago1-10ago1-11caf pnh wt 10ng 30ng60ng HD-ZIP III transcripts accumulate in PAZ mutants

miR165 is Expressed Abaxially in Leaf Primordia miR165 PHB/PHV

miR165 is Over and Ectopically Expressed in ago1 miR165

Adaxialised CAF AGO1 22nt miRNA AGO1 aaaaaaa mRNA miRNA precursor aaaaaaa PHB/PHV miR165

A Model for Leaf Development

CSHL Plant Group