Trumpet leaves and microRNA Catherine Kidner CSHL
Patterning events happen very early in leaf development
Processes in leaf development Down regulation of meristem-specific genes Growth and cell differentiation Establishment of axis
Stages of leaf development
rosette leaf cauline leaf Arabidopsis thaliana flower silque (fruit) lateral shoot 5 Chromosomes 125 Mega bases of DNA First plant genome sequenced (2001)
Patterning events happen very early in leaf development Trichome (hair) Interlocking epidermis Petiole Leaf blade expanding
Genes involved in leaf development YABBY (FIL) KANADI PHB STM AS1
Relative size Mutations in ARGONAUTE1 Cause Developmental Defects Stem cell defects Organ identity defects Organ polarity defects
Mapping Mutations in Arabidopsis
Populations of Arabidopsis
LandsbergColumbia Most ‘classical’ mutants Easiest to transform originally Compact, so easy to work with Most new insertion lines Easiest to transform now Full genome sequence Two lab strains
CAPs markers exploit the variation between the two strains catcgtcggggagttagatgtatatatatcgctgt catcgtcggggacttagatgtatatatatcgctgt Ler Col-0 Dde1 cttag
CAPS mapping ago-12/ago1-12+/+ Self F1 F2 Plants
ago-12 phenotype Wild type siblings L/L C/L C/C
The Role of ARGONAUTE
The ARGONAUTE family RG-richPAZPIWI RG-rich PAZ PIWI AGO family Piwi family
ago1-9 ago1-10 Strong ago1-12 Medium ago1-11 Weak An Allelic Series of ARGONAUTE1 Mutants RG-richPAZPIWI RG-richPAZPIWI
dsRNA siRNA RISC AGO aaaa Centromere function Viral defense PTGS Development RNA interference Science 2002
miRNA and the Role of AGO1 CAF AGO1 22nt miRNA AGO1 aaaaaaa mRNA miRNA precursor aaaaaaa mRNA degradation RISC
AGO1 and Development
Genes regulated by AGO1 One Step RT-PCR WT ago1-10 WT ago1-10 WT ago1-10 WT ago ng10ng1ng0.1ng AS1 ER AG CLF FIL KAN1 AP1 No Change Up in ago Down in ago No Change Down in ago No Change Total RNA
AGO1 is required for stem cell function ago1-11 ago1-11/ stm-2 Weak alleles of STM enhance weak alleles of AGO1 Strong alleles of AGO1 lack shoot apical meristems ago1-10
AGO1 is required for organ identity via UFO and LFY
ago1-12
ago1 has Adaxialised Organs FIL WT ago WT ago ER 100ng10ng1ng0.1ng ET2689 ET3964
caf-1 (weak) ago1-11 (weak) caf/caf, ago1-11/ago1-11 Strong caf alleles are embryo lethal miRNA Regulation is Required for Stem Cells and Polarity
The HD-ZIP III gene PHABULOSA is Associated with Adaxial Cell Fate WT Phab1-D/+ McConnell et al., 1999, 2001
homeo- domain START lipid-sterol binding domain leucine zipper At REVOLUTA3’ GGCCTGGTCCGAAGTAGG 5’ At PHABULOSA 3’ GGCCTGGTCCGAAGTAGG 5’ At PHAVOLUTA 3’ GGCCTGGTCCGAAGTAGG 5’ At miRNA1655’ CCGGACCAGGCTTCATCC 3’ At miRNA1665’ CCGGACCAGGCTTCATCC 3’ HD-ZIP III Genes are Targets of miRNA 1kb Reinhard et al., Llave et al., Parks et al., 2002 *
PHABULOSA PHAVOLUTA REVOLUTA TUBULIN RUBISCO ago1-10ago1-11caf pnh wt 10ng 30ng60ng HD-ZIP III transcripts accumulate in PAZ mutants
miR165 is Expressed Abaxially in Leaf Primordia miR165 PHB/PHV
miR165 is Over and Ectopically Expressed in ago1 miR165
Adaxialised CAF AGO1 22nt miRNA AGO1 aaaaaaa mRNA miRNA precursor aaaaaaa PHB/PHV miR165
A Model for Leaf Development
CSHL Plant Group