2/5/15 Objective: How does DNA replication occur? Do Now: S1f0.

Slides:

Advertisements

Similar presentations

DNA Replication (Sect 11.3) Objectives: Describe the structure and function of DNA and its role in the process of DNA replication.

Advertisements

DNA Replication. Each cell within a body contains the same DNA sequence. Why? Before the cell divides, an exact copy of DNA is made- process called REPLICATION.

DNA Review What does DNA store that is important? If a DNA strand read AGT-CCG-GTA what would the complimentary strand read? What holds the nitrogen bases.

DNA Replication DNA is replicated before cell division, when a cell divided into two cells.

DNA Replication. Cell Division and DNA Replication Cells divide -->Growth, Repair, Replacement Before cells divide they have to double cell structures,

Name one scientist who was involved in the discovery of the structure of the DNA molecule.

The Functions of DNA. 1. DNA has to replicate itself How does it make an exact copy?

January 13, 2015 Objective:  To be able to explain and model how DNA replicates  To describe how the structure of DNA relates to how it replicates Journal:

DNA Replication. The Model So far: Summarize in the top box, what you know about DNA structure. Why did we start with DNA in our question about how cells.

Topic 3: DNA Replication and Protein Synthesis Lesson 1: DNA Replication.

DNA Replication….some facts….. 1.Definition: Process by which DNA copies itself 2.Happens when chromosomes copy themselves before mitosis and meiosis (the.

DNA Replication. DNA Replication – What and Why Replication = DNA making copies of itself – DNA must be copied before a cell can divide – Each new cell.

Class Notes 2: DNA Replication. Replication Process.

Daily Trivia There are more bacteria and microbes in our body than actual cells that make up the body.

12-2 DNA Replication. The DNA Double Helix DNA Replication the process by which DNA makes a copy of itself occurs during interphase, prior to cell division.

DNA Replication.

III. DNA Replication A. Each chain of nucleotides of the DNA double helix has all the information needed to reconstruct the complementary chain of nucleotides.

DNA Replication. When and why must the DNA molecule be copied? Before cell division the DNA must be copied so that any new cells will have an identical.

DNA Replication To make two identical copies of DNA, the double helix is unwound and each strand is used as a template to make new strand. Complementary.

DNA Replication. Learning Targets Describe the replication of DNA. Explain semi-conservative replication and why it is important.

DNA REPLICATION Chapter 11, Section 1. DNA Review What is the building block of DNA? Nucleotides What is the shape of DNA? Double Helix What holds together.

Reviewing Nitrogen Base Pairs Which nitrogenous base always pairs with Cytosine (C)? _______________________ Which nitrogenous base always pairs with Adenine.

DNA Replication IB Topic 3.4 Campbell Chapter 16.

3 Question Challenge – 1/4 1. The complementary base to Adenine in DNA is ________? 2. The 3 parts of a nucleotide are a nitrogen base (A,T, C, or G);

{ DNA Replication.  When DNA makes an exact copy of itself.  Required step before cell division (making new cells).  DNA is the template / Enzymes.

Bell Work DNA replication is the process of making a copy of DNA. DNA replication occurs before a cell divides so each cell has a copy of DNA. Grab science.

DNA Replication EQ: How does the cell replicate the DNA in preparation for nuclear division. 1.

DNA Replication.

DNA Replication.

DNA Replication pp

How does DNA copy itself?

DNA Replication.

DNA Replication Learning Goal 1.

DNA Replication Associate the process of DNA replication with it’s biological significance.

DNA Replication Objective 2.

DNA REPLICATION Preparing for Mitosis.

SC. 912.L.3 Describe the basic process if DNA replication and how it relates to the transmission and conservation of the genetic information Objective:

DNA Replication.

DNA Replication.

DNA Replication.

Bell Work What are the base pairs?

Notes: DNA Replication Topic 2.

February 5, 2016 Objective: To be able to explain and model how DNA replicates To describe how the structure of DNA relates to how it replicates Journal:

DNA Replication Essential Question: How do enzymes help ensure DNA is copied correctly?

DNA Replication pp

1) To describe how the structure of DNA allows it to copy itself

DNA Replication.

DNA Replication.

DNA Replication Poster

DNA replication.

DNA Replication Helicase DNA Polymerase DNA Ligase

DNA Replication/ Regeneration

DNA Replication Notes.

DNA Replication.

DNA Replication.

DNA Part 1: DNA Structure and Replication

DNA Replication AP Biology Ch 16.2.

DNA Replication.

12-2: Chromosomes and DNA Replication

DNA REPLICATION Preparing for Mitosis.

DNA Replication.

8.3 DNA replication.

DNA Replication.

Where in a cell are the chromosomes found?

An Overview of the Process

Reviewing Nitrogen Base Pairs

DNA Replication There are _____ major steps to DNA Replication Result?

Presentation transcript:

2/5/15 Objective: How does DNA replication occur? Do Now: S1f0

. Write the missing strand: A C T G C T G Template

DNA Replication DNA replication: DNA makes a copy of itself What does “to replicate” mean? If you start with one strand of DNA, how many strands will you end up with?

When During what process does DNA replication occur? This occurs during cell division (mitosis) –Regeneration –Growth –Repair

DNA as a Template Template Strand: Original strand of DNA Complementary Strand: New strand of DNA ATTCGGTAATTCGGTA Template Strand -T -A -G -C -A -T Complimentary Strand

A closer look at DNA replication… ATCGCGCGCGTA A T C G T A ATCGCGCGCGTAATCGCGCGCGTA

Recall… What are the 2 functions of enzymes? DNA Helicase: An enzyme that “unwinds” or “unzips” the DNA strand

Recall… What are the 2 functions of enzymes? DNA Polymerase: An enzyme that attaches the complimentary base pairs to the template strand

DNA Simulation ATCTGATCTG

1tus

Turn and Talk With the person sitting next to you. In your notesheet under “How DNA replication occurs” write the steps of DNA replication, remembering what we did in the simulation to help you.

Summary Describe how DNA is replicated