DNA Synthesis

When must DNA remake itself? When must DNA remake itself? –Interphase  3 parts to Interphase  G1 – cell carries out normal functions  S – DNA is copied  G2 – Cell carries out normal functions Mitosis G1 S G2 Cell Cycle DNA Synthesis

What must be present for DNA to remake itself? What must be present for DNA to remake itself? –Original –Ink and paper –Photocopier Original DNA Nucleotide DNA Polymerase

Where do the “free” nucleotides come from? Where do the “free” nucleotides come from? –From the food that we eat  Adenine, Thymine, Cytosine, Guanine

What is an enzyme? What is an enzyme? –An enzyme is a protein –“Cellular Machine” that can build up or tear apart molecules.

What happens during DNA replication? What happens during DNA replication? a. - DNA unzips (enzyme used “helicase”)

b. - DNA polymerase attaches to DNA

c. - DNA polymerase copies DNA

A – T T – A G – C A – T C - G AT TA GC AT CG A – T – G – A – C – A T G A C T A C T G - T - A - C - T - G DNA is unzipped by helicase DNA is copied by DNA Polymerase

A – T T – A G – C A – T C - G ATTAGCATCGATTAGCATCG A – T – G – A – C – ATGACATGAC TACTGTACTG - T - A - C - T - G Template Strand Old DNA strand

A – T T – A G – C A – T C - G ATTAGCATCGATTAGCATCG A – T – G – A – C – ATGACATGAC TACTGTACTG - T - A - C - T - G Copy Strands New DNA Strand

6. How often are mistakes made? 1 mistake (mutation) every 1 million bases copied... but, doesn’t human DNA have 6 billion bases? So. doesn’t that mean 6,000 mistakes are made every time DNA synthesis happens? So. doesn’t that mean 6,000 mistakes are made every time DNA synthesis happens? % perfect!

7. Are mutations caused by other factors? Yes, radiation, ultraviolet light Yes, <1 mistake every 1 billion nucleotides! Repair Video Yes, <1 mistake every 1 billion nucleotides! Repair Video 8. Can mutations be repaired?

ANIMATIONS DNA Replication Video Mutations Video - Sickle Cell Anemia DNA Replication Song