Copyright OpenHelix. No use or reproduction without express written consent1
Melina II A Web-Based Tool for Promoter Analysis Materials prepared by: Sawsan Khuri, Ph.D. Version 3.0
Copyright OpenHelix. No use or reproduction without express written consent3 Melina II Agenda Introduction and Credits Basic Searches Explanation of Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:
Copyright OpenHelix. No use or reproduction without express written consent4 Introduction and Credits
Copyright OpenHelix. No use or reproduction without express written consent5 Melina II Credits algorithms references
Copyright OpenHelix. No use or reproduction without express written consent6 Melina II - Finding Help
Copyright OpenHelix. No use or reproduction without express written consent7 Melina II Agenda Introduction and Credits Basic Searches Summary of Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:
Melina II - Where to Start Copyright OpenHelix. No use or reproduction without express written consent8 FASTA FORMAT: >GENE_1_ID and a few words accgtgggatggacgctgagctgaccaaagct agatcgaatatagactagcatgatcggataga >GENE_2_ID and a few words atatagcagtcgggatggacgctgagctgata gatcgatgctagtcgatagctgatgcta >GENE_3_ID and a few words atcgatggtgctgataacacgatgctgacgat gctagatcgatcgagcatgggatggacgctga gctgacatccgact ¶ ¶
Copyright OpenHelix. No use or reproduction without express written consent9 Melina II - Basic Searches
Copyright OpenHelix. No use or reproduction without express written consent10 Input Example
Copyright OpenHelix. No use or reproduction without express written consent11 Job Running Job ID
Sneak Preview of Results Copyright OpenHelix. No use or reproduction without express written consent12
Copyright OpenHelix. No use or reproduction without express written consent13 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:
Copyright OpenHelix. No use or reproduction without express written consent14 Explaining the Algorithms - Consensus CONSENSUS:
Copyright OpenHelix. No use or reproduction without express written consent15 Melina II - Consensus Parameters scroll
Copyright OpenHelix. No use or reproduction without express written consent16 Explaining the Algorithms - MEME MEME:
Copyright OpenHelix. No use or reproduction without express written consent17 Melina II - MEME Parameters
Copyright OpenHelix. No use or reproduction without express written consent18 Explaining the Algorithms - Gibbs Gibbs Motif Sampler:
Melina II - Gibbs Parameters 19
Copyright OpenHelix. No use or reproduction without express written consent20 Explaining the Algorithms - MDscan MDscan:
Melina II - MDscan Parameters 21
Copyright OpenHelix. No use or reproduction without express written consent22 Choosing the Method
Explaining the Algorithms - More Information CONSENSUS: MEME: Gibbs Motif Sampler: MDscan: 23
Copyright OpenHelix. No use or reproduction without express written consent24 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:
Copyright OpenHelix. No use or reproduction without express written consent25 Understanding the Results - Left Hand Panel
Copyright OpenHelix. No use or reproduction without express written consent26 Understanding the Results - Summary View
Copyright OpenHelix. No use or reproduction without express written consent27 Understanding the Results - Navigation Tools
Copyright OpenHelix. No use or reproduction without express written consent28 Understanding the Results - the Zoom Tool
Copyright OpenHelix. No use or reproduction without express written consent29 Understanding the Results - the Fit Tool
Copyright OpenHelix. No use or reproduction without express written consent30 Understanding the Results - Lower Panel
Copyright OpenHelix. No use or reproduction without express written consent31 Understanding the Results - CONSENSUS clicked
Copyright OpenHelix. No use or reproduction without express written consent32 Understanding the Results - Gibbs Sequence Alignment Logo Diagram Further analysis clicked
Copyright OpenHelix. No use or reproduction without express written consent33 Understanding the Results - MDscan clicked Sequence Alignment Logo Diagram Further analysis
Copyright OpenHelix. No use or reproduction without express written consent34 Understanding the Results - MEME clicked
Copyright OpenHelix. No use or reproduction without express written consent35 Understanding the Results - Further Analysis
Copyright OpenHelix. No use or reproduction without express written consent36 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:
Copyright OpenHelix. No use or reproduction without express written consent37 Sequence Alignment Logo Diagram Further analysis Motifs Choose parameters Results Input sequences Summary
Copyright OpenHelix. No use or reproduction without express written consent38 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:
Copyright OpenHelix. No use or reproduction without express written consent39