Copyright OpenHelix. No use or reproduction without express written consent1.

Slides:



Advertisements
Similar presentations
Copyright OpenHelix. No use or reproduction without express written consent1.
Advertisements

Copyright OpenHelix. No use or reproduction without express written consent1 Organization of genomic data… Genome backbone: base position number sequence.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent 2 Overview of Genome Browsers Materials prepared by Warren C. Lathe, Ph.D.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
The UCSC Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña CNIO Bioinformatics.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
GVS: Genome Variation Server Materials prepared by: Warren C. Lathe, PhD Updated: Q Version 2.
Copyright OpenHelix. No use or reproduction without express written consent1.
Tools in Bioinformatics Genome Browsers. Retrieving genomic information Previous lesson(s): annotation-based perspective of search/data Today: genomic-based.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1 1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright OpenHelix. No use or reproduction without express written consent1.
Copyright 2017 © Condry & Associates, Inc. + All rights reserved *
An Introduction to Designing and Executing Workflows with Taverna
Presentation transcript:

Copyright OpenHelix. No use or reproduction without express written consent1

Melina II A Web-Based Tool for Promoter Analysis Materials prepared by: Sawsan Khuri, Ph.D. Version 3.0

Copyright OpenHelix. No use or reproduction without express written consent3 Melina II Agenda Introduction and Credits Basic Searches Explanation of Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:

Copyright OpenHelix. No use or reproduction without express written consent4 Introduction and Credits

Copyright OpenHelix. No use or reproduction without express written consent5 Melina II Credits algorithms references

Copyright OpenHelix. No use or reproduction without express written consent6 Melina II - Finding Help

Copyright OpenHelix. No use or reproduction without express written consent7 Melina II Agenda Introduction and Credits Basic Searches Summary of Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:

Melina II - Where to Start Copyright OpenHelix. No use or reproduction without express written consent8 FASTA FORMAT: >GENE_1_ID and a few words accgtgggatggacgctgagctgaccaaagct agatcgaatatagactagcatgatcggataga >GENE_2_ID and a few words atatagcagtcgggatggacgctgagctgata gatcgatgctagtcgatagctgatgcta >GENE_3_ID and a few words atcgatggtgctgataacacgatgctgacgat gctagatcgatcgagcatgggatggacgctga gctgacatccgact ¶ ¶

Copyright OpenHelix. No use or reproduction without express written consent9 Melina II - Basic Searches

Copyright OpenHelix. No use or reproduction without express written consent10 Input Example

Copyright OpenHelix. No use or reproduction without express written consent11 Job Running Job ID

Sneak Preview of Results Copyright OpenHelix. No use or reproduction without express written consent12

Copyright OpenHelix. No use or reproduction without express written consent13 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:

Copyright OpenHelix. No use or reproduction without express written consent14 Explaining the Algorithms - Consensus CONSENSUS:

Copyright OpenHelix. No use or reproduction without express written consent15 Melina II - Consensus Parameters scroll

Copyright OpenHelix. No use or reproduction without express written consent16 Explaining the Algorithms - MEME MEME:

Copyright OpenHelix. No use or reproduction without express written consent17 Melina II - MEME Parameters

Copyright OpenHelix. No use or reproduction without express written consent18 Explaining the Algorithms - Gibbs Gibbs Motif Sampler:

Melina II - Gibbs Parameters 19

Copyright OpenHelix. No use or reproduction without express written consent20 Explaining the Algorithms - MDscan MDscan:

Melina II - MDscan Parameters 21

Copyright OpenHelix. No use or reproduction without express written consent22 Choosing the Method

Explaining the Algorithms - More Information CONSENSUS: MEME: Gibbs Motif Sampler: MDscan: 23

Copyright OpenHelix. No use or reproduction without express written consent24 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:

Copyright OpenHelix. No use or reproduction without express written consent25 Understanding the Results - Left Hand Panel

Copyright OpenHelix. No use or reproduction without express written consent26 Understanding the Results - Summary View

Copyright OpenHelix. No use or reproduction without express written consent27 Understanding the Results - Navigation Tools

Copyright OpenHelix. No use or reproduction without express written consent28 Understanding the Results - the Zoom Tool

Copyright OpenHelix. No use or reproduction without express written consent29 Understanding the Results - the Fit Tool

Copyright OpenHelix. No use or reproduction without express written consent30 Understanding the Results - Lower Panel

Copyright OpenHelix. No use or reproduction without express written consent31 Understanding the Results - CONSENSUS clicked

Copyright OpenHelix. No use or reproduction without express written consent32 Understanding the Results - Gibbs Sequence Alignment Logo Diagram Further analysis clicked

Copyright OpenHelix. No use or reproduction without express written consent33 Understanding the Results - MDscan clicked Sequence Alignment Logo Diagram Further analysis

Copyright OpenHelix. No use or reproduction without express written consent34 Understanding the Results - MEME clicked

Copyright OpenHelix. No use or reproduction without express written consent35 Understanding the Results - Further Analysis

Copyright OpenHelix. No use or reproduction without express written consent36 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:

Copyright OpenHelix. No use or reproduction without express written consent37 Sequence Alignment Logo Diagram Further analysis Motifs Choose parameters Results Input sequences Summary

Copyright OpenHelix. No use or reproduction without express written consent38 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II:

Copyright OpenHelix. No use or reproduction without express written consent39