Daisy Robinton Matt Emmer Jason Chai What Are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock-Out Mutations? Daisy Robinton Matt Emmer Jason Chai

Isolation of DNA From Plant

Determining DNA Quality

How do we Know if There is an Insert? Genotyping provides evidence for a T-DNA insert Genotyping is done by PCR amplification of the DNA sequence of our gene with our gene-specific primers along with a primer for the T-DNA insert We know of two ways to genotype 1. Multiplex Reaction 2. Separating Primers

How do we find the Insert via Genotyping? LB FW agggtcttctcgatgtagatatgcggaagat RV

Multiplex Reaction Wild Type Wild Type Heterozygous

Separating Primers

Sequencing Steps Cut mutant band from gel Sequence band Set up sequencing reaction Submit to sequencing center Use Phred and Finch TV to analyze file Determine T-DNA orientation BLAST Align 2 Sequences Compare to expected results

The Dideoxy Sequencing Process Direction of Read

Interpretation Sequencing Results FINCH TV

Components of Performing a BLAST

The Bioinformatics Process

How to Determine a Mutant Phenotype? Phenotyping Plants: Observe phenotypical differences between wildtype and homozygous mutants Study seeds with Microscope Observe embryological differences by utilizing the Nomarski microscope