Suppl. figure 1 Zale et al. 215E 223D 211E218E230E 36E 209F 23E 208F 236E212E213E 203D 210E 221D 207E WRI OLE DGA GAPDH 5E 100D 6B 25B 32D 206E205E 21E.

Slides:

Advertisements

Similar presentations

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Advertisements

35S P.tAPX or GUS intronNOS T. G P.XVET3A Lex A P.ccdB G P.XVET3A Lex A P. tAPX or GUS intron Xba I pGWB80/tAPX (or GUS) pMDC7 A B C pMDC7/tAPX.

Lecture 19, Chapter 11 Analysis of transgenic plants part II Neal Stewart.

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

-The methods section of the course covers chapters 21 and 22, not chapters 20 and 21 -Paper discussion on Tuesday - assignment due at the start of class.

How do you identify and clone a gene of interest? Shotgun approach? Is there a better way?

Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal.

Figure S1. Genomic PCR of in vitro potato plants transformed with StPTB1 prom (top) and StPTB6 prom (bottom) constructs using nptII-specific primers. Thirty.

Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.

A B M145  mbl::aac  mbl C24  mbl C24 M C24  mbl::aac M145  mbl-2  mbl1 M red sco2450 mbl sco2450 aac frt B bp B B

1kb PpABA1 gene model AtABA1 gene model (a) (b) ATGTAA ATG TAA Fig. S1. Characterization of the PpABA1 gene. (a) AtABA1 and PpABA1 gene models. The PpABA1.

Recombinant DNA What is the basis of recombinant DNA technology? How does one “clone” a gene? How are genetically modified organisms (GMOs) created? Illustration.

AP Biology Biotech Tools Review AP Biology Biotech Tools Review  Recombinant DNA / Cloning gene  restriction enzyme, plasmids,

Molecular Biology II Lecture 1 OrR. Restriction Endonuclease (sticky end)

(a) #30 #37 #39 (b)(c) PtaZFP2 relative expression (d) PtaZFP2 relative expression Time after 17β-estradiol addition (h)

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Workpackage 2: Breeding Systems

DNA Technology Ch. 20. The Human Genome The human genome has over 3 billion base pairs 97% does not code for proteins Called “Junk DNA” or “Noncoding.

Molecular Cloning. Definitions   Cloning :   Obtaining a piece of DNA from its original source (Genome) and introducing it in a DNA vector   Sub-cloning:

Volume 5, Issue 2, Pages (March 2012)

Table A. Sequences used in making CsKASII RNAi constructs

Midterm Breakdown Part I Part II: Part III : 8 calculations

Reads aligned into contigs

Invest. Ophthalmol. Vis. Sci ;44(2): doi: /iovs Figure Legend:

Accumulation of transcripts from MULE‐F19G14–CyP40 and transposons in mom1 and ddm1. Accumulation of transcripts from MULE‐F19G14–CyP40 and transposons.

Figure S3 Gui kb a TP b Figure S3 Southern hybridization analysis of hygromycin.

Biotechnology: Part 1 DNA Cloning, Restriction Enzymes and Plasmids

Biotech Tools Review

Vascular Endothelial-Specific Dimethylarginine Dimethylaminohydrolase-1–Deficient Mice Reveal That Vascular Endothelium Plays an Important Role in Removing.

Vav‐1 gene‐targeting strategy.

Skin-Specific Expression of ank-393, a Novel Ankyrin-3 Splice Variant

Consequences of T‐DNA insertion on SWP expression in swp mutant.

Isothermal Multiple Displacement Amplification

Molecular Biology Restriction enzymes.

Volume 5, Issue 2, Pages (March 2012)

Brca1 Controls Homology-Directed DNA Repair

Volume 122, Issue 4, Pages (August 2005)

Highly efficient lentiviral-mediated human cytokine transgenesis on the NOD/scid background by Isabel Punzon, Luis M. Criado, Alfredo Serrano, Fernando.

Npl3 functions as an independent export adaptor for the pre‐60S ribosomal subunit. Npl3 functions as an independent export adaptor for the pre‐60S ribosomal.

Silencing in Yeast rDNA Chromatin

Xiaofeng Cao, Steven E. Jacobsen Current Biology

MYO5A Gene Is a Target of MITF in Melanocytes

Disruption of the BGLF2 gene decreased infectious progeny production.

Volume 154, Issue 6, Pages (September 2013)

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Molecular cloning of pms916 salt hypersensitive T-DNA mutant.

Structure of the GM2A Gene: Identification of an Exon 2 Nonsense Mutation and a Naturally Occurring Transcript with an In-Frame Deletion of Exon 2 Biao.

Volume 18, Issue 2, Pages (April 2005)

Jung-Ok Han, Sharri B Steen, David B Roth Molecular Cell

FLS2 Molecular Cell Volume 5, Issue 6, Pages (June 2000)

NILV‐S/MAR‐mediated transgene expression

A Prematurely Expressed Igκ Transgene, but Not a VκJκ Gene Segment Targeted into the Igκ Locus, Can Rescue B Cell Development in λ5-Deficient Mice Roberta.

Volume 128, Issue 3, Pages (March 2005)

APOE Gene Targeting (A) Schematic representation of the endogenous APOE locus, the gene targeting vector and the targeted APOE locus. The exons of the.

Material for Quiz 5 from Chapter 8

Impact of RTEL1 variants on telomere maintenance.

Multiple Developmental Stage–Specific Enhancers Regulate CD8 Expression in Developing Thymocytes and in Thymus-Independent T Cells Wilfried Ellmeier,

Stella Plakidou-Dymock, David Dymock, Richard Hooley Current Biology

NILV‐S/MAR‐mediated transgene expression

Targeting strategy and molecular verification of myoglobin disruption.

Volume 16, Issue 4, Pages (April 2002)

Inactivation of the Dp1 locus.

BAC recombineering, gene targeting and RMCE strategies.

Fig. 4. Targeted disruption of STK35 transcripts in mouse.

Securin is not required for cellular viability, but is required for normal growth of mouse embryonic fibroblasts Junjie Mei, Xingxu Huang, Pumin Zhang

Jiamiao Lu, Feijie Zhang, Mark A Kay Molecular Therapy

Expression and function of fragment N in RIP-N mice.

A Stage-Specific Enhancer of Immunoglobulin J Chain Gene Is Induced by Interleukin-2 in a Presecretor B Cell Stage Chang-Joong Kang, Colleen Sheridan,

A Counterdefensive Strategy of Plant Viruses

Volume 2, Issue 4, Pages (July 2009)

Presentation transcript:

Suppl. figure 1 Zale et al. 215E 223D 211E218E230E 36E 209F 23E 208F 236E212E213E 203D 210E 221D 207E WRI OLE DGA GAPDH 5E 100D 6B 25B 32D 206E205E 21E 204D 15D WRI OLE DGA GAPDH 216D 229E 3E 110D 222E 13A 21B 1E 32E 29D 19B 200E 3B 23C 5A 16C 38A12A 25C 28A26A WRI OLE DGA GAPDH 214D231D 220E225E 37E 227E 219D 36E 224E WRI OLE DGA GAPDH 27A WT 102 6A 32A 233 Suppl. Figure 1 Endpoint RT-PCR analyses of WRI1, OLE1, and DGAT 1-2 expression in trans genic sugarcane. WT: Wildtype plant. Sugarcan e GAPDH gene was used as an internal control.

PWTW61E29D19B28C PWTW61E29D19B28C (a) (b) (c) PWTW61E29D19B28C (d) WT1E29D19B5B28C Suppl. figure 2 Zale et al.

Suppl. Figure 2 Southern blot analyses of transgenic sugarcane lines. A DNA samples from t ransgenic sugarcane lines regenerated after bombardment with WRI1/nptII or co-bombarded with all plasmids and probed for WRI1. Genomic DNA was digested with EcoRI. The probe w as generated by PCR to the coding region of WRI1 using primers forward primer (TGCATCG ACTCCTCCACCATC) and reverse primer (TGATGATGCACCAGGTAGTTGC). Plasmid (P) is the 8.8 Kb linearized pJK403NPTII vector; WT= Wildtype sugarcane; Transgenic sugarcane l ines: W6, 1E, 29D19B, and 28C. W6 was bombarded with WRI1/nptII. All other lines were c o-bombarded with all plasmids. B) DNA samples from transgenic sugarcane lines regenerate d after co-bombardment with all plasmids and probed for OLE1. Plasmid (P) is the 8.7 Kb lin earized pJK vector; WT= Wildtype sugarcane; Transgenic sugarcane lines: 1E to 28C. Genomic DNA was digested with HindIII. The probe was generated by PCR to the coding regi on of DGAT1-2 using forward primer (ACTGGCCGCTGCTGATGTGCTG) and reverse prime r (ACGCGCTCGATGGCGTTCAGG). C) DNA samples from transgenic sugarcane lines rege nerated after co-bombardment with all plasmids and probed for OLE1. Plasmid (P) is the 8.7 Kb linearized pJK vector; WT= Wildtype sugarcane; Transgenic sugarcane lines co-bo mbarded with all plasmids 1E to 28C. Genomic DNA was digested with HindIII. The probe wa s generated by PCR to the coding region of OLE1 using primer forward primer (ACCCACCA CGACATCATCGG)and reverse primer (GTGCGGTCGCGGTCGTGCTC). D) DNA samples f rom transgenic sugarcane lines regenerated after co-bombardment with all plasmids and prob ed for PXA1/AGPase. WT= Wildtype sugarcane; 1E to 28C transgenic sugarcane lines. Geno mic DNA was digested with BamHI. The probe was generated by PCR to the BG intron using primer forward primer (ACTACCTACTCCAAAACAAAGC) and reverse primer (ATAGAGGAC ACTTTGGCGCG).

Suppl. figure 3 Zale et al. (a)

Suppl. Figure 3 (a) Fatty acid profile of TAG from wild-type and transgenic sugarcane immatur e leaves. (b) Fatty acid profile of TAG from wild-type and transgenic sugarcane immature stems. 25C and 233: Transgenic lines with co-expression of WRI1, DAGAT1-2 and OLE1 and co-suppr essing PXA1 and AGPase. WT: Wildtype plant. Error bar indicates standard error of the mean. Mean represents average of analysis from two independent progeny plants per line.