2007-2008 A Lot More Advanced Biotechnology Tools (Part 2) Sequencing.

Slides:



Advertisements
Similar presentations
Biotechnology
Advertisements

Genome Projects A genome project is the complete DNA sequence of the genome of an organism, and the identification of all its genes Genome projects are.
The DNA Story Germs, Genes, and Genomics 4. Heredity Genes DNA Manipulating DNA.
DNAStructureandReplication. Transformation: Robert Griffith (1928)
© Wiley Publishing All Rights Reserved. Using Nucleotide Sequence Databases.
Human Genome Project What did they do? Why did they do it? What will it mean for humankind? Animation OverviewAnimation Overview - Click.
The chemical Basis of Inheritance. Chromatin / Chromosomes.
Model Organisms & Tools of Cell Biology Lecture 3 Autumn 2007.
Basic Molecular Biology Many slides by Omkar Deshpande.
Workshop: computational gene prediction in DNA sequences (intro)
living organisms According to Presence of cell The non- cellular organism The cellular organisms According to Type the Eukaryotes the prokaryotes human.
A Lot More Advanced Biotechnology Tools DNA Sequencing.
The Human Genome Project Ashley Osborne Quesha McClanahan Orchi Haghighi.
Summer Bioinformatics Workshop 2008 Chi-Cheng Lin, Ph.D., Professor Department of Computer Science Winona State University – Rochester
Topics The topics: basic concepts of molecular biology more on Perl
Chi-Cheng Lin, Ph.D. Associate Professor Department of Computer Science Winona State University – Rochester Center Introduction to Bioinformatics.
Model Organisms and Databases. Model Organisms Characteristics of model organisms in genetics studies –Genetic history well known –Short life cycle; large.
Goals of the Human Genome Project determine the entire sequence of human DNA identify all the genes in human DNA store this information in databases improve.
The Human Genome Project Public: International Human Genome Sequencing Consortium (aka HUGO) Private: Celera Genomics, Inc. (aka TIGR)
What is genomics? Study of genomes. What is the genome? Entire genetic compliment of an organism.
Elements of Molecular Biology All living things are made of cells All living things are made of cells Prokaryote, Eukaryote Prokaryote, Eukaryote.
Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?
Regents Biology Genetic Engineering Biotechnology.
AP Biology Biotechnology AP Biology A Brave New World.
Electrophoresis & RFLPs
Human Genome Project. In 2003 scientists in the Human Genome Project obtained the DNA sequence of the 3 billion base pairs making up the human genome.
AP Biology A Lot More Advanced Biotechnology Tools Sequencing.
Introduction to Bioinformatics CPSC 265. Interface of biology and computer science Analysis of proteins, genes and genomes using computer algorithms and.
Write down what you know about the human genome project.
Part 1: Basic Biotechnology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA.
Genomics and Its Impact on Science and Society: The Human Genome Project and Beyond U.S. Department of Energy Genome Programs
AP Biology From Gene to Protein How Genes Work AP Biology Nucleolus Function  ribosome production build ribosome subunits from rRNA & proteins exit.
This presentation was originally prepared by C. William Birky, Jr. Department of Ecology and Evolutionary Biology The University of Arizona It may be used.
Section 2 Genetics and Biotechnology DNA Technology
Genome Organization & Evolution. Chromosomes Genes are always in genomic structures (chromosomes) – never ‘free floating’ Bacterial genomes are circular.
Sevas Educational Society All Rights Reserved, 2008 Module 1 Introduction to Bioinformatics.
Genomics and Arabidopsis. What is ‘genomics’? Study of an organism’s entire genome –All the DNA encoded in the organism –Nucleus, mitochondria, chloroplasts.
© 2015 W. H. Freeman and Company CHAPTER 1 The Genetics Revolution Introduction to Genetic Analysis ELEVENTH EDITION Introduction to Genetic Analysis ELEVENTH.
Protein Synthesis Making Proteins
Regents Biology Genetic Engineering Biotechnology.
Control of Prokaryotic (Bacterial) Genes Gene Control  Many biotech techniques make use of existing mechanisms for controlling gene expression  Gene.
Brief Overview of Macromolecules DNA, RNA, and Proteins.
Chapter 1 Introduction.
Biotechnology (Ch.20) A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA.
Bailee Ludwig Quality Management. Before we get started…. ….Let’s see what you know about Genomics.
Genes & Chromosomes Chromosomes - single large DNA molecule and its associated proteins, containing many genes; stores & transmits genetic info Gene -
A Lot More Advanced Biotechnology Tools Sequencing.
Biotechnology Methods of working with DNA started in the 1970s. A key accomplishment was the invention of techniques for making recombinant DNA- these.
Define each of these terms: Chromosome: Gene: Allele: Genome: Mutation:
Genome They are the volums of an encyclopaedia called Genome. Cell Nucleus Tissues The chromosomes contains the instruction of alive beings.
Biotechnology
Bioinformatic PhD. course Bioinformatics Xavier Messeguer Peypoch ( LSI Dep. de Llenguatges i Sistemes Informàtics BSC Barcelona.
Chapter 11 Meiosis & Genetics What do you think meiosis makes?
Chapter 2 Genome Organization and Evolution Dr Achraf El Allali.
Eukaryotic genes are interrupted by large introns. In eukaryotes, repeated sequences characterize great amounts of noncoding DNA. Bacteria have compact.
Chapter 17 – 18 Biotechnology: Genomics & DNA Technology.
Regents Biology Biotechnology Gel Electrophoresis.
1 Annotation of the bacteriophage 933W genome: an in- class interactive web-based exercise.
What does the draft human genome sequence tell us?
(B) Amplification and detection of DNA sequences.
What does the draft human genome sequence tell us?
EL: To find out what a genome is and how gene expression is regulated
Genomes Genes and Alleles
Genomes and Their Evolution
CHMI 2227E Biochemistry I Gene expression
Every living organism inherits a blueprint for life from its parents.
Evolution of eukaryote genomes
Basic Molecular Biology
In 2003 scientists in the Human Genome Project achieved a long-sought goal by obtaining the DNA sequence of the 3.2 billion base pairs (the order of As,
A Lot More Advanced Biotechnology Tools
Presentation transcript:

A Lot More Advanced Biotechnology Tools (Part 2) Sequencing

Human Genome Project On June 26, 2001, HGP published the “working draft” of the DNA sequence of the human genome. Historic Event! – blueprint of a human – the potential to change science & medicine

Sequence of 46 Human Chromosomes 3 billion base pairs 3G of data

TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA CATCGACCTGCTCGTACATGCTACTAGCTACTG ACTCATGATCCAGATCACTGAAACCCTAGATC GGGTACCTATTACAGTACGATCATCCGATCAGA TCATGCTAGTACATCGATCGATACTGCTACTGA TCTAGCTCAATCAAACTCTTTTTGCATCATGAT ACTAGACTAGCTGACTGATCATGACTCTGATCC CGTAGATCGGGTACCTATTACAGTACGATCATC CGATCAGATCATGCTAGTACATCGATCGATACT GCTACTGATCTAGCTCAATCAAACTCTTTTTGC ATCATGATACTAGACTAGCTGACTGATCATGAC TCTGATCCCGTAGATCGGGTACCTATTACAGTA CGATCATCCGATCAGATCATGCTAGTACATCGA TCGATACT human genome 3.2 billion bases

Raw genome data

NCBI GenBank Database of genetic sequences gathered from research Publicly available on Web!

Organizing the data

Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene polypeptide 1 polypeptide 2 polypeptide 3 protein gene It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like. RNA gene

And we didn’t stop there…

The Progress First 2 bacterial genomes complete 122+ bacterial genomes Data from NCBI and TIGR ( and ) first eukaryote complete (yeast) first metazoan complete (flatworm) 17 eukaryotic genomes complete or near completion including Homo sapiens, mouse and fruit fly Official “15 year” Human Genome Project: # of DNA base pairs (billions) in GenBank

How does the human genome stack up? Organism Genome Size (bases) Estimated Genes Human (Homo sapiens) 3 billion30,000 Laboratory mouse (M. musculus) 2.6 billion30,000 Mustard weed (A. thaliana) 100 million25,000 Roundworm (C. elegans) 97 million19,000 Fruit fly (D. melanogaster) 137 million13,000 Yeast (S. cerevisiae) 12.1 million6,000 Bacterium (E. coli) 4.6 million3,200 Human Immunodeficiency Virus (HIV) 97009