Input: Alignment. Model parameters from neutral sequence Estimation example.

Slides:

Advertisements

Similar presentations

Hidden Markov Model in Biological Sequence Analysis – Part 2

Advertisements

Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.

Profiles for Sequences

Genome-wide Regulatory Complexity in Yeast Promoters Zhu YANG 15 th Mar, 2006.

Bioinformatics Finding signals and motifs in DNA and proteins Expectation Maximization Algorithm MEME The Gibbs sampler Lecture 10.

Lecture 6, Thursday April 17, 2003

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method  25-bp window in the human genome 

Hidden Markov Models Sasha Tkachev and Ed Anderson Presenter: Sasha Tkachev.

CS273a Lecture 10, Aut 08, Batzoglou CS273a Lecture 10, Fall 2008 Neutral Substitution Rates.

Journal club 06/27/08. Non-coding functional regions Cis-regulation of pre-mRNA splicing Post-splicing (mature mRNA) – degradation, localization Translational.

Evolution at the DNA level …ACGGTGCAGTTACCA… …AC----CAGTCCACCA… Mutation SEQUENCE EDITS REARRANGEMENTS Deletion Inversion Translocation Duplication.

CS273a Lecture 8, Win07, Batzoglou Evolution at the DNA level …ACGGTGCAGTTACCA… …AC----CAGTCCACCA… Mutation SEQUENCE EDITS REARRANGEMENTS Deletion Inversion.

1 Detecting selection using phylogeny. 2 Evaluation of prediction methods  Comparing our results to experimentally verified sites Positive (hit)Negative.

CS273a Lecture 11, Aut 08, Batzoglou Multiple Sequence Alignment.

Investigating the Importance of non-coding transcripts.

O AK R IDGE N ATIONAL L ABORATORY U.S. D EPARTMENT OF E NERGY 1 Identifying Regulatory Transcriptional Elements on Functional Gene Groups Using Computer-

CS273a Lecture 9/10, Aut 10, Batzoglou Multiple Sequence Alignment.

[Bejerano Fall09/10] 1 Milestones due today. Anything to report?

Finding Regulatory Motifs in DNA Sequences

Short Primer on Comparative Genomics Today: Special guest lecture 12pm, Alway M108 Comparative genomics of animals and plants Adam Siepel Assistant Professor.

CIS786, Lecture 8 Usman Roshan Some of the slides are based upon material by Dennis Livesay and David.

Journal club 06/27/08. Phylogenetic footprinting A technique used to identify TFBS within a non- coding region of DNA of interest by comparing it to the.

BNFO 602/691 Biological Sequence Analysis Mark Reimers, VIPBG

Sequencing a genome and Basic Sequence Alignment

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

© Wiley Publishing All Rights Reserved.

BNFO 602/691 Biological Sequence Analysis Mark Reimers, VIPBG

MicroRNA Targets Prediction and Analysis. Small RNAs play important roles The Nobel Prize in Physiology or Medicine for 2006 Andrew Z. Fire and Craig.

Guiding Motif Discovery by Iterative Pattern Refinement Zhiping Wang, Mehmet Dalkilic, Sun Kim School of Informatics, Indiana University.

CRB Journal Club February 13, 2006 Jenny Gu. Selected for a Reason Residues selected by evolution for a reason, but conservation is not distinguished.

Good solutions are advantageous Christophe Roos - MediCel ltd Similarity is a tool in understanding the information in a sequence.

Motif finding with Gibbs sampling CS 466 Saurabh Sinha.

Module 3 Sequence and Protein Analysis (Using web-based tools) Working with Pathogen Genomes - Uruguay 2008.

Sequencing a genome and Basic Sequence Alignment

Construction of Substitution Matrices

Copyright OpenHelix. No use or reproduction without express written consent1.

HMMs for alignments & Sequence pattern discovery I519 Introduction to Bioinformatics.

Computational Genomics and Proteomics Lecture 8 Motif Discovery C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.

Protein and RNA Families

Overview of Bioinformatics 1 Module Denis Manley..

Localising regulatory elements using statistical analysis and shortest unique substrings of DNA Nora Pierstorff 1, Rodrigo Nunes de Fonseca 2, Thomas Wiehe.

Proposed redefinition of “gene” requires it to have a biological role Gerstein MB, …, Snyder M Genome Res 17: example of complexities observed.

Motif discovery and Protein Databases Tutorial 5.

Mark D. Adams Dept. of Genetics 9/10/04

Comp. Genomics Recitation 9 11/3/06 Gene finding using HMMs & Conservation.

From Genomes to Genes Rui Alves.

MEME homework: probability of finding GAGTCA at a given position in the yeast genome, based on a background model of A = 0.3, T = 0.3, G = 0.2, C = 0.2.

Pattern Discovery and Recognition for Genetic Regulation Tim Bailey UQ Maths and IMB.

Multiple Species Gene Finding using Gibbs Sampling Sourav Chatterji Lior Pachter University of California, Berkeley.

. Finding Motifs in Promoter Regions Libi Hertzberg Or Zuk.

I.U. School of Informatics Motif Discovery from Large Number of Sequences: A Case Study with Disease Resistance Genes in Arabidopsis thaliana by Irfan.

2016/1/27Summer Course1 Pattern Search Problems Part I: Fundament Concept.

Hidden Markov Model and Its Application in Bioinformatics Liqing Department of Computer Science.

Intro to Probabilistic Models PSSMs Computational Genomics, Lecture 6b Partially based on slides by Metsada Pasmanik-Chor.

(H)MMs in gene prediction and similarity searches.

Pattern Discovery and Recognition for Understanding Genetic Regulation Timothy L. Bailey Institute for Molecular Bioscience University of Queensland.

Week 8. Homework 7 2 state HMM – State 1: neutral – State 2: conserved Emissions: alignment columns – Alignment of human, dog, mouse sequences AATAAT.

A high-resolution map of human evolutionary constraints using 29 mammals Kerstin Lindblad-Toh et al Presentation by Robert Lewis and Kaylee Wells.

HW7: Evolutionarily conserved segments ENCODE region 009 (beta-globin locus) Multiple alignment of human, dog, and mouse 2 states: neutral (fast-evolving),

Katherine S. Pollard Gladstone Institutes, Institute for Human Genetics and Division of Biostatistics - UCSF What makes us human?

1 Discovery of Conserved Sequence Patterns Using a Stochastic Dictionary Model Authors Mayetri Gupta & Jun S. Liu Presented by Ellen Bishop 12/09/2003.

Gibbs sampling.

Genome alignment Usman Roshan.

Eukaryotic Gene Finding

Finding Functionally Significant Structural Motifs in Proteins

Finding regulatory modules

A mutation is a change in an organism’s DNA.

Problems from last section

Discussion Section Week 9

Sequence Analysis Alan Christoffels

Presentation transcript:

Input: Alignment. Model parameters from neutral sequence Estimation example

Estimation example 2

HMM version

Protein Coding Gene Known non-coding gene: XIST ch10 chX RepA Different gene conservation patterns

Find a ML estimator for using the EM algorithm. Score: Decompose Q by “extracting” the stationary distribution: R: Neutral substitution pattern : Site specific forces Estimating

Unlikeliness Score Rate Score Comparison

43% vs 16% detection by vs. Proof of concept

Gene and gene regulation

GTACTAAGCTACTGTATGGAGGCT Human Mouse *****GAGC**********ATGC* Dog *****AGGT**********CGGC* Bat *****AGCT**********AGAC* Find regions in the alignment whose substitution pattern is explained by the motif. x x x A generalization: Conserved motif discovery

P53 MDM2 Novel non coding gene M. Huarte, O. Zuk, M. Guttman P53 Motif instance conservation