RNA-Seq in Galaxy Igor Makunin DI/TRI, March 9, 2015.

Slides:

Advertisements

Similar presentations

Information on GVL - Genomics Virtual Laboratory Oct 2013 Audience: Service Desk Developed as part of the Australian.

Advertisements

Before we start Login to the laptop: user: crgcomu Password: crgcomu Login to the network: Wifi: carretwifi Password : Login to galaxy (ldap):

NGS Bioinformatics Workshop 2.1 Tutorial – Next Generation Sequencing and Sequence Assembly Algorithms May 3rd, 2012 IRMACS Facilitator: Richard.

IMGS 2012 Bioinformatics Workshop: File Formats for Next Gen Sequence Analysis.

IMGS 2012 Bioinformatics Workshop: RNA Seq using Galaxy

Differentially expressed genes Sample class prediction etc.

Bio-IT World Asia Conference 2013 A Genomics Virtual Lab for Cancer Research Dominique Gorse.

MCB Lecture #21 Nov 20/14 Prokaryote RNAseq.

RNA-seq Analysis in Galaxy

Biological Sequence Analysis BNFO 691/602 Spring 2014 Mark Reimers

Bacterial Genome Assembly | Victor Jongeneel Radhika S. Khetani

Before we start: Align sequence reads to the reference genome

NGS Analysis Using Galaxy

An Introduction to RNA-Seq Transcriptome Profiling with iPlant

Introduction to RNA-Seq and Transcriptome Analysis

National Center for Genome Analysis Support: Carrie Ganote Ram Podicheti Le-Shin Wu Tom Doak Quality Control and Assessment.

Genomics Virtual Lab: analyze your data with a mouse click Igor Makunin School of Agriculture and Food Sciences, UQ, April 8, 2015.

Computer Lab (I) Introduction of galaxy and UCSC genome browser.

Transcriptome analysis With a reference – Challenging due to size and complexity of datasets – Many tools available, driven by biomedical research – GATK.

File formats Wrapping your data in the right package Deanna M. Church

Bio-IT World Asia, June 7, 2012 High Performance Data Management and Computational Architectures for Genomics Research at National and International Scales.

RNAseq analyses -- methods

Introduction to RNA-Seq & Transcriptome Analysis

Galaxy for Bioinformatics Analysis An Introduction TCD Bioinformatics Support Team Fiona Roche, PhD Date: 31/08/15.

NGS data analysis CCM Seminar series Michael Liang:

Next Generation DNA Sequencing

Next Generation Sequencing. Overview of RNA-seq experimental procedures. Wang L et al. Briefings in Functional Genomics 2010;9: © The Author.

RNA-Seq in Galaxy Igor Makunin QAAFI, Internal Workshop, April 17, 2015.

RNA-seq workshop ALIGNMENT

An Introduction to RNA-Seq Transcriptome Profiling with iPlant.

Introductory RNA-seq Transcriptome Profiling. Before we start: Align sequence reads to the reference genome The most time-consuming part of the analysis.

Introduction to RNA-Seq

The iPlant Collaborative Community Cyberinfrastructure for Life Science Tools and Services Workshop RNA-Seq using the Discovery Environment And COGE.

NIH Extracellular RNA Communication Consortium 2 nd Investigators’ Meeting May 19 th, 2014 Sai Lakshmi Subramanian – (Primary

-- Don Preuss NCBI/NLM/NIH

Chip – Seq Peak Calling in Galaxy Lisa Stubbs Chip-Seq Peak Calling in Galaxy | Lisa Stubbs | PowerPoint by Casey Hanson.

Cloud Implementation of GT-FAR (Genome and Transcriptome-Free Analysis of RNA-Seq) University of Southern California.

Introductory RNA-seq Transcriptome Profiling. Before we start: Align sequence reads to the reference genome The most time-consuming part of the analysis.

RNA-Seq Primer Understanding the RNA-Seq evidence tracks on the GEP UCSC Genome Browser Wilson Leung08/2014.

RNA-Seq Transcriptome Profiling. Before we start: Align sequence reads to the reference genome The most time-consuming part of the analysis is doing the.

Data Workflow Overview Genomics High- Throughput Facility Genome Analyzer IIx Institute for Genomics and Bioinformatics Computation Resources Storage Capacity.

Introduction to RNAseq

Bioinformatics for biologists Dr. Habil Zare, PhD PI of Oncinfo Lab Assistant Professor, Department of Computer Science Texas State University Presented.

An Introduction to RNA-Seq Transcriptome Profiling with iPlant (

First of all: “Darnit Jim, I’m a doctor not a bioinformatician!”

Moderní metody analýzy genomu - analýza Mgr. Nikola Tom Brno,

Chip – Seq Peak Calling in Galaxy Lisa Stubbs Lisa Stubbs | Chip-Seq Peak Calling in Galaxy1.

Case study: Saccharomyces cerevisiae grown under two different conditions RNAseq data plataform: Illumina Goal: Generate a platform where the user will.

User-friendly Galaxy interface and analysis workflows for deep sequencing data Oskari Timonen and Petri Pölönen.

Introduction to Exome Analysis in Galaxy Carol Bult, Ph.D. Professor Deputy Director, JAX Cancer Center Short Course Bioinformatics Workshops 2014 Disclaimer…I.

Canadian Bioinformatics Workshops

Visualizing data from Galaxy

Introductory RNA-seq Transcriptome Profiling of the hy5 mutation in Arabidopsis thaliana.

What should a bioinformatician know about DNA sequencing, and why?

Canadian Bioinformatics Workshops

Introductory RNA-seq Transcriptome Profiling

Computing challenges in working with genomics-scale data

Cancer Genomics Core Lab

WS9: RNA-Seq Analysis with Galaxy (non-model organism )

NGS Analysis Using Galaxy

Chip – Seq Peak Calling in Galaxy

S1 Supporting information Bioinformatic workflow and quality of the metrics Number of slides: 10.

How to store and visualize RNA-seq data

Introductory RNA-Seq Transcriptome Profiling

MapView: visualization of short reads alignment on a desktop computer

Storing and Accessing G-OnRamp’s Assembly Hubs outside of Galaxy

ChIP-seq Robert J. Trumbly

Additional file 2: RNA-Seq data analysis pipeline

Chip – Seq Peak Calling in Galaxy

Presentation transcript:

RNA-Seq in Galaxy Igor Makunin DI/TRI, March 9, 2015

Genomics Virtual Lab GVL site: The main aim: facilitate the genomics research in Australia Galaxy: Tutorials and protocols (nextGen sequencing) Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy for full-scale analysis: galaxy-qld.genome.edu.au “roll your own” GVL platform on the Australian government funded computer infrastructure (NeCTAR cloud): - virtual computer cluster - Galaxy - IPython Notebook - RStudio Mirror of UCSC Genome Browser RStudio Learn Use Get

Plan Our goals for today: Introduction to Galaxy platform -FASTQ quality score encoding in Galaxy Analysis of differential gene expression using nextGen sequencing data Workflows in Galaxy Sites: Galaxy-tut: Galaxy-qld: Genomics Virtual Lab: All GVL resources are public

Galaxy: how does it look like Tools Working window Data

Good user practice for Galaxy-qld GVL Galaxy in Queensland: galaxy-qld.genome.edu.au Register with your UQ and get a bigger disk allocation. Use ftp for big datasets – it is faster. Galaxy recognises.gz compression. Do not store unneeded datasets. Delete temporary files such as SAM. Purge deleted datasets. Do not start many big jobs in parallel (BWA, bowtie, bowtie2, tophat, tophat2, velvet, trinity). Create and use workflows for multi-step analysis. Specify the quality score encoding for nextGen sequencing data (FASTQ files).

FASTQ quality score ILLUMINA-96BC32_0028_FC:3:1:8035:1092/1 TAGCAGCACATCATGGTTTACATCGTATGCCGTCTT + IIHIDIIIIIIIIIIIIIHIHIIIIIDGIBGGGGGG Qual. = 39 Offset = 33 ASCII(72): H

FASTQ quality score in Galaxy Many old illumina datasets have a proprietary data encoding (offset 64) Currently most NGS datasets use Sanger encoding (offset 33) Galaxy By default Galaxy assign ‘fastq’ data type to uploaded FASTQ files. In this case the offset is not specified, and many tools do not recognize the data fastqillumina – old illumina quality score encoding (offset 64) fastqsanger – new illumina / Sanger quality score encoding Nearly all modern NGS data use Sanger encoding (fastqsanger in Galaxy) Solution: -specify a proper format, eg fastqsanger or fastqillumina, during the data upload -change the format via Attributes > Datatype

Differential gene expression Basic GVL Galaxy tutorial based on Trapnell et al. (2012) Nature Protocols. Import data Align to a reference genome (tophat) Find differentially expressed genes (Cuffdiff) mRNA Library Reads Number of reads correlates with gene expression level.

Thank you! GVL site: Galaxy for tutorials: galaxy-tut.genome.edu.augalaxy-tut.genome.edu.au Galaxy Queensland: galaxy-qld.genome.edu.augalaxy-qld.genome.edu.au Contributors and participants: