The primer of primers

The Basic Concept Goal – chop out a specific section of DNA (to make LOTS of copies of it) To do that, it is necessary to know the sequences on the ends of that section. From there the corresponding nucleotides can be discovered. These are PRIMERS.

If Life Were Simple… You could just take a DNA sequence and use its complement and call that a primer

But Of Course… Life isn’t simple. Primers only code 5’ to 3’ so… which strand you are on matters, and… which direction you want to go matters

First you start with a block For example, You want to clone the region between genes SSA3 and RPS8A on S. exiguus chromosome #2 Let’s look at that region…

From

Reminder… How genes are aligned Watson strand Crick strand This will be even more important later on

Note that SSA3 is “downstream” of RPS8A on Crick strand

So to make copies of the area between the genes… SSA3RPS8A a Our primers need to be at the END of RPS8A and at the START of SSA3

To make a good primer It needs to be at least 20 bases long It must be VERY conserved (18/20 bases or better) The 3’ end should have an intact series The melting point must be between 50º C and 60º C (more later on this) The corresponding primer must have a temperature within two degrees of this primer

Let’s look at SSA3 Open the alignment There are no ideal primers at the start But down 12 lines, there is the following: CGTGGTGGTGAAGATTTTGATAAAT CACGGTGGTGAAGATTTCGATAACA CCGGGTGGTGAAGATTTTGATAACT * ************** ***** Take the majority rule and use T in the blank. We have a primer! (Almost)

But we have a problem (of course) The gene would be coding in the wrong direction. We need to prime the area in BETWEEN the two genes. Primer Target We can’t simply reverse the sequence, because we can’t work 3’ to 5’ But what if we used the complementary strand?!

YES!!! By using primers on different strands going opposite directions, we can get our segment

So back to our sequence CGTGGTGGTGAAGATTTTGATA AAT CACGGTGGTGAAGATTTCGATA ACA CCGGGTGGTGAAGATTTTGATA ACT * ************** ***** We must use the reverse complement of the SSA3 gene so we use TTATCAAAATCTTCACCACC as our primer

MELTING POINT This is easy (relatively) Every A or T is worth 2ºC Every G or C is worth 4ºC Just add for the temperature This is easy (relatively) Every A or T is worth 2ºC Every G or C is worth 4ºC Just add for the temperature TTATCAAAATCTTCACCACC HIGH SCORE INITIALS PCR 54

Second Primer Follow the same process, but because we’re on the right strand headed the right direction, we only need use the sequence, not the reverse complement But remember, this time we’re looking at the END of the alignment. RPS8ASSA3

Look at RPS8A At the end is a string of 26 completely conserved nucleotides. YEAY! So what we need to do is find one with a melting point within two degrees, preferable an identical point. By monkeying with where we cut our primer, we can find an exact match

We now have a set of primers The END

Special Thanks Katherine for teaching all this to me Dr. Cliften for teaching this to her Atari for their stellar video games