Supplementary Figure S1. Schematic structure of hardwood xylan. GlcA, glucuronic acid; Me, methyl; Ac, acetyl; Xyl, xylose. Arabidopsis genes most closely.

Slides:

Advertisements

Similar presentations

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Advertisements

Genomic Organization and Evolutionary Conservation of Plant D-Type Cyclins by Margit Menges, Giulio Pavesi, Piero Morandini, Laszlo Bögre, and James A.H.

1 LSM2241 AY0910 Semester 2 MiniProject Briefing Round 5.

AP Biology DNA Study Guide. Chapter 16 Molecular Basis of Heredity The structure of DNA The major steps to replication The difference between replication,

PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1.

Supplemental Figure S1. Correlation between T6P, and sugar phosphates. A, T6P and glucose 6-phosphate. B, T6P and glucose 1-phosphate and fructose 6-phosphate.

Supplementary Fig. S1. 16S RNA Neighbor-joining (NJ) tree of Brevibacterium metallicus sp. nov. NM2E3 T (in bold) and related species of genus Brevibacterium.

A B C D E F G H I J K FigS1. Supplemental Figure S1. Evolutionary relationships of Arabidopsis and tomato Aux/IAA proteins. The evolutionary history was.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Molecular Evolution. Study of how genes and proteins evolve and how are organisms related based on their DNA sequence Molecular evolution therefore is.

Figure 1 Myotubularin exhibits a tyrosine phosphatase activity

Supplementary figure 5.

Volume 2, Issue 5, Pages (September 2009)

Alignment table: group 4

by Yong Du, Aqing Yao, Dengfu Guo, Tadashi Inagami, and Donna H. Wang

Volume 88, Issue 5, Pages (March 1997)

Figure A. Molecular phylogenetic tree of β-catenin and related proteins. The human E-cadherin and α-catenin were used for root tree. Phylogenetic analyses.

AtIAA18 AtIAA6 AtIAA19 VvIAA19 AtIAA10 AtIAA20 AtIAA7 AtIAA30 AtIAA11

Phylogenetic analysis of CADs and oxidoreductases involved in specialized metabolism (ORSMs). Phylogenetic analysis of CADs and oxidoreductases involved.

Volume 55, Issue 3, Pages (March 1999)

Transcription -The main purpose of transcription is to create RNA from DNA because RNA leaves the nucleus to carry out its functions but DNA does not -A.

Gene Expression of Mouse S100A3, a Cysteine-Rich Calcium-Binding Protein, in Developing Hair Follicle Kenji Kizawa, Suguru Tsuchimoto, Keiko Hashimoto,

Molecular Evolution.

Eukaryote Regulation and Gene Expression

Motif 1 Motif 3 Motif 6 Motif 2 Motif 5 Motif 4 Motif 4 Motif 1

HAX-1, Identified by Differential Display Reverse Transcription Polymerase Chain Reaction, Is Overexpressed in Lesional Psoriasis Alireza Mirmohammadsadegh,

Volume 61, Issue 5, Pages (May 2002)

Volume 3, Issue 3, Pages (May 2010)

Stem Cell Regulation by Arabidopsis WOX Genes

HKAP1.6 and hKAP1.7, Two Novel Human High Sulfur Keratin-Associated Proteins are Expressed in the Hair Follicle Cortex Yutaka Shimomura, Noriaki Aoki,

Galactose Biosynthesis in Arabidopsis

Volume 101, Issue 5, Pages (May 2000)

Volume 9, Issue 8, Pages (August 2016)

TGF‐β1 and Sema3A are downregulated in vivo by increasing VEGF doses Muscles were harvested 7 days after implantation of V Low, V Med, and V High clones.

Volume 93, Issue 7, Pages (June 1998)

Volume 3, Issue 2, Pages (March 2010)

Comprehensive Hybrid Capture–Based Next-Generation Sequencing Identifies a Double ALK Gene Fusion in a Patient Previously Identified to Be False-Negative.

Volume 88, Issue 5, Pages (March 1997)

Figure 1: The full-length cDNA and deduced amino acid sequences of Lysozyme C and amino acid sequences from rock bream, Oplegnathus fasciatus. The primers.

WEREWOLF, a MYB-Related Protein in Arabidopsis, Is a Position-Dependent Regulator of Epidermal Cell Patterning Myeong Min Lee, John Schiefelbein Cell

A Novel Family of Candidate Pheromone Receptors in Mammals

Lee Chanhui , Teng Quincy , Zhong Ruiqin , Ye Zheng-Hua

Volume 2, Issue 5, Pages (September 2009)

Isolation and Characterization of a Putative Keratin-Associated Protein Gene Expressed in Embryonic Skin of Mice Mikiro Takaishi, Yoshimi Takata, Toshio.

Μ-Crystallin, Thyroid Hormone-binding Protein, is Expressed Abundantly in the Murine Inner Root Sheath Cells Noriaki Aoki, Kaoru Ito, Masaaki Ito Journal.

Volume 7, Issue 2, Pages (August 2004)

DNA Topoisomerase VI Is Essential for Endoreduplication in Arabidopsis

Whorl-Specific Expression of the SUPERMAN Gene of Arabidopsis Is Mediated by cis Elements in the Transcribed Region Toshiro Ito, Hajime Sakai, Elliot.

Volume 1, Issue 4, Pages (April 2005)

The abcc6a Gene Expression Is Required for Normal Zebrafish Development Qiaoli Li, Sara Sadowski, Michael Frank, Chunli Chai, Andras Váradi, Shiu-Ying.

A Novel Family of Mammalian Taste Receptors

Expression of the AREB1 Gene and Subcellular Localization of the AREB1 Protein.(A) Structure of AREB1 family proteins. Expression of the AREB1 Gene and.

Volume 15, Issue 6, Pages (December 2008)

Stella Plakidou-Dymock, David Dymock, Richard Hooley Current Biology

Two cycad AOX genes, CrAOX1 and CrAOX2, showing different expression patterns in thermogenic male cones. Two cycad AOX genes, CrAOX1 and CrAOX2, showing.

PtrHB7, a class III HD-Zip Gene, Plays a Critical Role in Regulation of Vascular Cambium Differentiation in Populus Yingying Zhu, Dongliang Song, Jiayan.

Phylogenetic analyses of alphacoronaviruses based on complete genome and ORF1ab protein sequence. Phylogenetic analyses of alphacoronaviruses based on.

Volume 2, Issue 2, Pages (March 2009)

7 WT 6 irx1-6 ixr fold increased expression 3 2 n- 1 AT1G18710

Phylogenetic analysis of AquK2P.

Horizontal gene transfer and the evolution of cnidarian stinging cells

Volume 14, Issue 9, Pages (May 2004)

Volume 3, Issue 3, Pages (May 2010)

A Novel Family of Putative Pheromone Receptors in Mammals with a Topographically Organized and Sexually Dimorphic Distribution Gilles Herrada, Catherine.

Geographical distribution (A) and historical information (B) for tigers in the Russian Far East that died or were killed due to abnormal neurologic behavior.

S protein sequence-based phylogenetic analyses of alphacoronaviruses.

Conserved Functions of Arabidopsis and Rice CC-Type Glutaredoxins in Flower Development and Pathogen Response Zhen Wang, Shuping Xing, Rainer P. Birkenbihl,

Volume 15, Issue 6, Pages (March 2005)

Characterization of GmSIN1.

Volume 1, Issue 5, Pages (September 2008)

Presentation transcript:

Supplementary Figure S1. Schematic structure of hardwood xylan. GlcA, glucuronic acid; Me, methyl; Ac, acetyl; Xyl, xylose. Arabidopsis genes most closely associated with synthesis of these features in Arabidopsis xylan are indicated. IRX9, IRX10, IRX14 GUX GXM TBL29 IRX7, IRX8, PARVUS

Supplementary Figure S2. Phylogenetic trees showing the relationship between the willow cDNA sequences cloned to make in situ probes and the Arabidopsis and poplar genes in the same clades. Multiple alignments of protein sequences generated by MUSCLE were used to generate consensus trees using PHYML with WAG model from 500 bootstrap runs, visualised using Geneious package.

Supplementary Figure S3. Amino acid alignments of three willow transcripts selected for in situ probes to closest Arabidopsis and poplar homologues.

Supplementary Figure S4. Example of differential expression of IRX10 transcripts around the stem in a 4-week plantlet. Bar = 250µm.

Supplementary Figure S5. Control sections showing no staining. a 4-week old stem hybridized with the IRX10 sense probe b 6- week old stem hybridized with the IRX9 sense probe. Bars: 100 µm.