Figure S1 Figure S1. Infection with fluorescently tagged S. marcescens establish an infection in the fly’s intestine. To show that oral infection by feeding was efficient, we used the S. marcescens Db11-GFP strain (gift from D. Ferrandon, IBMC, Strasbourg, France) to show ingestion and localization of the bacteria in the intestinal lumen. (A) A dissected midgut after 24 hours of oral infection with Db11-GFP. (B) Enlargement of the anterior region. The white lined area corresponds to the luminal space of the intestinal canal. The white narrows mark the ingested fluorescent bacteria.

Figure S2

Figure S2. To evaluate the concentration-dependency of Serratia-induced transcription factor translocation, standardized experiments employing different bacterial concentration were used for infection. Transcription factor reporter lines were used and different bacterial concentrations were used. From top to bottom the different infection conditions are represented, ranging from OD 600 =0.5 [D, E, F] up to OD 600 =50 [S, T, U], all compared to control conditions by ingestion of 5% sucrose only [A, B, C]. The left column [A, D, G, J, M, P, S] shows Dorsal (NP1-Gal4>pUAST-EGFP-dorsal). In the middle column the Imd-dependent transcription factor Relish (NP1-Gal4>pUAST-EYFP-relish) is shown [B, E, H, K, N, Q, T]. Here, in E the copper cell region is shown. There was no translocation in the enterocytes at all, but we first recognized the translocation to the copper cells by an infection with OD 600 =1. Right figures [C, F, I, L, O, R, U] show translocation of TF dfoxO (NP1-Gal4>pUAST-foxO-GFP). Translocation of FoxO starts at low concentrations (OD = 1). Scale bar is 20 µm. Fly strains pUAST-EYFP-relish (Tony Ip, Massachusetts) pUAST-EGFP-dorsal (Tony Ip, Massachusetts) pUAST foxo GFP (selfmade, Tina) NP1-GAL4 (D. Ferrandon, Straßburg) Figure S2

Figure S3 2 h α-Relishα-dFoxO DAPI 4 h 6 h 8 h DAPI C B‘‘‘B‘BB‘‘ D‘‘‘ D‘ D C‘‘ C‘ C‘‘‘ D‘ ‘ E‘‘‘ E‘ EE‘‘ G AA‘‘A‘A‘‘‘ 0 h 8 h F‘‘‘ F‘ FF‘‘

Figure S3 Figure S3. Time-course of the Infection-dependent translocation of dFoxO and Relish in enterocytes (ECs). To show that the translocation of FoxO in response to an infection (and the lack of translocation of Relish) is no artifact of the indicator lines used, we performed time-course experiments employing immunohistochemistry. In these time course experiment flies from the wild type strain w 1118 were infected with pathogenic bacteria (S. marcescens Db11) for 2 h [B], 4 h [C], 6 h [D], and 8 h [E]. Controls were only fed with 5% sucrose [A]. The images are representative for enterocytes of the anterior midgut. Nuclei were stained with Hoechst (blue) [A’-G’]. Antibody-staining was like followed: α-Relish (red) [A’’-G’]’ and α-dFoxO (green) [A’’’-G’’’]. The co-localization of all staining is represented in [A-G]. Relish is not detectable in the nuclei of the enterocyte at any time point of the experiment. dFoxO instead shows nuclear translocation after a 8 h infection period [E’’’]. At higher magnification, this becomes more obvious [G’’’]. Scalebar is 20 µm.

Figure S4. Relative expression levels of FoxO target genes. To compare the gene expression after oral infection in wildtype w 1118 and foxo-impaired foxo 21/21 depicted in figure 1, we here investigated the inducible expression of the same target genes by constitutive overexpression of foxo in enterocytes (NP1-Gal4 X UAS-foxo, grey bars; control, black bars). n = 5 for both conditions, statistical analysis was performed with the Mann-Whitney test. Asteriks label statistically significant differences to matching controls (p<0.05). Figure S4 * * * * * * * control foxo-OE

Figure S5

Figure S5. Time-course of the Infection-dependent translocation of dFoxO and Relish in copper cells (CCs). As shown in figure S3, we employed immunohistochemitry to see the effects of an oral infection on translocation behavior in copper cells. Flies of the w 1118 strain were infected with S. marcescens Db11 and the translocation of FoxO and Relish was studied. The location of the transcription factors Relish and dFoxO was detected using specific antibodies. Time course experiments were performed for 2 h [B], 4 h [C], 6 h [D], 8 h [E] and 24 h [F]. Controls were fed with 5% sucrose only [A]. Nuclei were stained with Hoechst (blue) [A’-F’]. Antibody-staining was as following: α-Relish (red) [A’’-F’]’ and α-dFoxO (green) [A’’’-F’’’]. The translocation of Relish in the Copper cells starts after 6 hours of bacteria feeding [D’’] and is even present after 24 hours of infection [F’’] in the nucleus. The transcription factor dFoxO is not triggered at any time point and is remaining in the cytoplasm. Scalebar is 20 µm.

Figure S6 Figure S6. Confirmation of the inducible overexpression using the ternary TARGET- expression system. To evidence the functionality of induced overexpression using the TARGET expression system we have done qPCR analysis. For the IMD-signalling pathway we induced the increased expression of the soluble pattern recognition receptor PGRP-LE and for FoxO-signalling the transcription factor dFoxO itself. To prove that we have a clear amplification of the target genes we used gene specific primers for the cDNA synthesis (see above). (A) shows the efficient expression of PGRP-LE after 24 hours of heatshock activation (29°C) in comparison to their controls kept at 17°C. We see a hundredfold increased expression of PGRP-LE. Likewise we see an increased expression of the inducible dFoxO after 24 hours of heatshock activation in comparison to its control. Only difference is the x-fold change which is only fivefold to control expression.

Table S2. Influence of dFoxO and IMD on Db11 infection survival. sexstrain Db11 (OD 600 >50) Median life span (d) Decrease in Median life span (% of control) Chi- Square (χ2) p-value ♂ w ♂ w ♂ dFoxO-KO < ♂ dFoxO-KO +11 ♂ IMD-KO < ♂ IMD-KO +16 ♀ w < ♀ w ♀ dFoxO-KO < ♀ dFoxO-KO +12 ♀ IMD-KO < ♀IMD-KO +2.5 Data derived from log rank analysis of the survival curves shown in Fig. 4. Log rank test was performed using GraphPad Prism Experiments shown are representatives of four independent experiments., each with 10 flies per vial.

Supplemental materials Infection by feeding For the concentration-dependent infection experiments (Figure S3), Serratia marcescens culture we serially diluted to the initial concentration of OD 600 =50 with a sterile sucrose solution (5 %) and to the final concentrations with the following ODs: OD 600 =50, OD 600 =25, OD 600 =10, OD 600 =5, OD 600 =5, OD 600 =1, OD 600 =0.5. The bacterial/sucrose solution contained 1 % E133 brilliant blue food coloring dye. One absorbent filter (37mm; Millipore) was placed into a fly culture tubes and soaked with 350 µl of the S. marcescens sucrose solution. The flies were then transferred to these infectious vials for 24 hours at 29°C in a bench incubator with 12/12 h day-night-rhythm. The intestines were dissected in PBS buffer and then mounted in Roti®-Mount FluorCare DAPI (Carl Roth GmbH & Co. KG, Karlsruhe, Germany). Images were captured with the Imager.Z1 equipped with an Apotome (Zeiss, Göttingen, Germany). Immunohistochemistry Immunohistochemistry for Relish and FoxO was performed using standard protocols and anti-Relish (21F3, DSHB, Iowa, USA) as well as anti-FoxO (Cosmo Bio, Cologne, Germany) antibodies. DyLight 549 Goat anti mouse and DyLight 488 donkey anti rabbit antibodies (Jackson Immuno Research, Hamburg, Germany) were used as secondary antibodies. Oligonucleotide sequences rpL32 sense CCGCTTCAAGGGACAGTATC – antisense GACAATCTCCTTGCGCTTCT pgrp-Sc2 sense AACTACCTGAGCTACGCCGTG. – antisense AGCAGAGGTGAGGGTGTTGGT thor sense CTCCTGGAGGCACCAAACTT. antisense GAGTTCCCCTCAGCAAGCAA upd3 sense GAGAACACCTGCAATCTGAA – antisense AGAGTCTTGGTGCTCACTGT attB sense ACAATCTGGATGCCAAGGTC – antisense TGTCCGTTGATGTGGGAGTA attD sense AGTGGGGGTCACTAGGGTTC antisense AGGTGATGATTGGCACTTCC lip4 sense TTCTGATGCAGGGATTGGCA antisense GGGGTAACTTACGCTCACCG attacin A sense CAATCTGGATGCCAAGGTCT - antisense TCCCGTGAGATCCAAGGTAG defensin sense GCTATCGCTTTTGCTCTGCT - antisense GCCGCCTTTGAACCCCTTGG diptericin sense GCAATCGCTTCTACTTTGGC - antisense TAGGTGCTTCCCACTTTCCA drosomycin sense ACCAAGCTCCGTGAGAACCTT -antisense TTGTATCTTCCGGACAGGCAG cecropin C sense AAGATCTTCGTTTTCGTCGC - antisense GTTGCGCAATTCCCAGTC metchnikowin sense CCACCGAGCTAAGATGCAA - antisense AATAAATTGGACCCGGTCTTG drosocin sense GTTCACCATCGTTTTCCTGC - antisense GGCAGCTTGAGTCAGGTGAT PGRP-LE sense ACGAGCCACTGCCCTTGCAAC - antisense AGTCTTACGTTGATCGCCCGC foxo sense GCATGCACAATGCAAGAGAT - antisense GCCTCGTTATTGAGCACCTC