DNA sequencing. How DNA synthesis takes place inside the living cell?

Slides:

Advertisements

Similar presentations

Lecture 44 Prof Duncan Shaw. Recombinant DNA technology First technical breakthrough in medical genetics was chromosome analysis in 1950s Second is recombinant.

Advertisements

Polymerase Chain Reaction

PCR way of copying specific DNA fragments from small sample DNA material "molecular photocopying" It’s fast, inexpensive and simple Polymerase Chain Reaction.

Polymerase Chain Reaction (PCR). PCR produces billions of copies of a specific piece of DNA from trace amounts of starting material. (i.e. blood, skin.

Detection of the human Mitochondrial DNA A Polymerase Chain Reaction Experiment.

SEQUENCING-related topics 1. chain-termination sequencing 2. the polymerase chain reaction (PCR) 3. cycle sequencing 4. large scale sequencing stefanie.hartmann.

DNA Synthesis. Last time: n DNA is the chemical substance that serves as the genetic material (exception: RNA in some viruses) n Today: In order to pass.

Additional Powerful Molecular Techniques Synthesis of cDNA (complimentary DNA) Polymerase Chain Reaction (PCR) Microarray analysis Link to Gene Therapy.

Cycle Sequencing. Broad and Long Term Objective To characterize a single clone from an Emiliania huxleyi cDNA library using sequence analysis To characterize.

I-5-1 Basic Principles and Components of PCR NSYSU CHUNG-LUNG CHO.

PCR Polymerase Chain Reaction. PCR - a method for amplifying (copying) small amount of DNA in nearly any amount required, starting with a small initial.

DNA Sequencing. ? ? DNA extraction PCR Gel electrophoresis Insect identification ACAGATGTCTTGTAATCCGGC CGTTGGTGGCATAGGGAAAG GACATTTAGTGAAAGAAATTG ATGCGATGGGTGGATCGATG.

DNA Sequencing.

General Genetics. PCR 1.Introduce the students to the preparation of the PCR reaction. PCR 2.Examine the PCR products on agarose gel electrophoresis.

Genomic DNA purification

Learning Objectives Draw or model the first three cycles of PCR, including the correct directionality (5’- and 3’-ends) of the primers and single-stranded.

DNA Replication DNA mRNA protein transcription translation replication Before each cell division the DNA must be replicated so each daughter cell can get.

HIV GENOTYPE ASSAY Anabelia Perez, MLT (ASCP) Molecular Technologist August 6, 2008.

Automated DNA Sequencing LECTURE 7: Biotechnology; 3 Credit hours Atta-ur-Rahman School of Applied Biosciences (ASAB) National University of Sciences and.

DNA Sequencing Today, laboratories routinely sequence the order of nucleotides in DNA. DNA sequencing is done to: Confirm the identity of genes isolated.

1.) DNA Extraction Follow Kit Grind sample Mix with solution and spin Bind, Wash, Elute.

CULTURE INDEPENDENT ANALYSIS OF MICROBIAL COMMUNITIES IN SOIL

Polymerase Chain Reaction (PCR)

6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.

PCR POLYMERASE CHAIN REACTION Dauphin Island Graduate Neurobiology.

EDVOKIT#300: Blue/White Cloning of a DNA Fragment

Polymerase Chain Reaction (PCR) What is PCR?: Use of DNA polymerase to selectively amplify a segment of DNA from a much larger sample. Xeroxing DNA, start.

1 Chapter 2: DNA replication and applications DNA replication in the cell Polymerase chain reaction (PCR) Sequence analysis of DNA.

Chapter 14: DNA Amplification by Polymerase Chain Reaction.

PCR condition EF taq Tm : 45~60 ℃ Template : gDNA 2 95 ℃ 2 min 95 ℃ 30 sec Tm 20 sec (30cycles) 72 ℃ 4 min 72 ℃ 5 min 4 ℃ 연대의대 소아과 - PCR results (gDNA.

Ancient Lake non-isolated pothole River where pupfish can swim from pothole to pothole. isolated potholes Hypothesis is that there was an ancient lake.

The polymerase chain reaction

A program of ITEST (Information Technology Experiences for Students and Teachers) funded by the National Science Foundation Background Session #5 Polymerase.

The polymerase chain reaction

6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.

Sequencing by the Sanger Dideoxynucleotide Chain Termination Method 1. Prepare replication template denature, add synthetic primer, promote annealing TAGGCGA.

Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’

Amplification of a DNA fragment by Polymerase Chain Reaction (PCR) Ms. Nadia Amara.

Detection of the human VNTR using PCR* *A Polymerase Chain Reaction Experiment.

Sanger or Dideoxy DNA Sequencing

DNA Sequencing Sanger Di-deoxy method of Sequencing Manual versus Automatic Sequencing.

Semiconservative DNA replication Each strand of DNA acts as a template for synthesis of a new strand Daughter DNA contains one parental and one newly synthesized.

DNA Sequencing Hunter Jones, Mitchell Gage. What’s the point? In a process similar to PCR, DNA sequencing uses a mixture of temperature changes, enzymes.

The Polymerase Chain Reaction (PCR)

PCRPCR Presented by : Rana AL-Turki. 1- Definition of PCR. 2- Requirements for PCR. 3-PCR Process. 4-Procedure.

Lab 22 Goals and Objectives: EDVOKIT#300: Blue/White Cloning of a DNA Fragment Calculate transformation efficiencies Compare control efficiency to cloned.

Lecturer: Bahiya Osrah Background PCR (Polymerase Chain Reaction) is a molecular biological technique that is used to amplify specific.

Rajan sharma.  Polymerase chain reaction Is a in vitro method of enzymatic synthesis of specific DNA sequences.  This method was first time developed.

I. PCR- Polymerase Chain Reaction A. A method to amplify a specific piece of DNA. DNA polymerase adds complementary strand DNA heated to separate strands.

Section 4 Lesson 3– PCR. PCR – The Polymerase Chain Reaction PCR is a technique used to amplify specific sequences of DNA. This technique can be used.

Experimental Practice Detection of genetically modified DNA-components in food by polymerase-chain-reaction (PCR) Introduction.

Polymerase Chain Reaction (PCR)

PCR conditions: 94ºC for 15 min

EDVOKIT#300: Blue/White Cloning of a DNA Fragment

Sequencing Introduction

Polymerase Chain Reaction (PCR)

DNA Sequencing Techniques

copying & sequencing DNA

Molecular Cloning: Polymerase Chain Reaction

Polymerase Chain Reaction

Polymerase Chain Reaction

16.3 – In vitro cloning Polymerase Chain Reaction

3. PCR Page 376 – 377.

DNA Sequence Determination (Sanger)

PCR -PCR replicates (or amplifies) the DNA many times so that a large enough sample can be analyzed.

Polymerase Chain Reaction

DNA Sequencing A population of DNA fragments is generated.

Polymerase Chain Reaction

Dr. Israa ayoub alwan Lec -12-

Setting up your Sequencing reaction

Presentation transcript:

DNA sequencing

How DNA synthesis takes place inside the living cell?

Can you think of a way to determine the DNA seq. in vitro?

The idea of DNA sequencing The use of ddNTPs + the normal dNTPs

There are 2 methods for DNA sequencing 1- Classic sequencing Using radioactivity 2- Modern sequencing Using fluorescence

The classic sequencing Sanger Chain termination method

Modern sequencing Chain termination method

Steps for DNA sequencing 1- DNA isolation and purification 2- PCR 3- Amplified DNA purification 4- Termination 5- Sequencing

1- DNA isolation and purification Obtain high quality DNA to be sequenced 1- Conc. by spec * Calculation ……. 2- Integration

2- Is PCR for sequencing different from the general PCR

3- Amplified DNA purification

General PCR components

General PCR strategy

PCR Program

PCR objective

PCR for sequencing Components of PCR Template + terminator ready reaction mix.

The PCR program Hot start 2 min Den o C Annealing 5 50 o C Extension 4 60 o C 25 cycles

Seq. PCR end product What are the characteristics of the resulted DNA?

How to handle the DNA after this point Purification Termination Sequencing

What happens inside the sequencer

Review over the sequencing process