NOTES – CH 17, part 2 DNA & MUTATIONS

Slides:

Advertisements

Similar presentations

Mutations A mutation is a permanent change in the DNA or RNA sequence of a gene. There are two ways in which DNA can become mutated: 1.Mutations can be.

Advertisements

Chapter 17.5 Gene expression and Mutations

Lesson Overview 13.3 Mutations.

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

Mutations are changes in genetic material

Lesson Overview Lesson OverviewMutations Lesson Overview 13.3 Mutations.

Topic 8 From Gene …to Protein Biology 1001 October 17, 2005.

5. Point mutations can affect protein structure and function

Mutations 3.29 Recall that mutation is a rare, random change in genetic material that can be inherited. 3.31 Understand that many mutations are harmful.

DNA, Mutations and Hazardous Waste. Prokaryote Cell.

Definition : Any change in the nucleotide sequence of DNA.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Ch Mutations Section Objectives:

Gene Mutations Chapter 11.

Chapter 14 Homework is due on Sunday, January 25 at 11:59 pm The Chapter 13 and 14 test is on Monday.

Microbial Genetics - Mutation l Mutation - Introduction –A mutation is a change in the DNA sequence that results in a change in the product protein –Mutations.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

Chapter 11.6 Mutations. Definition- Mutation- a change in the DNA nucleotide sequence Mutation- a change in the DNA nucleotide sequence Types of mutations:

Mutations. What comes to mind???? Mutants.

Mutations Can Change the Meaning of Genes CH 11 Section 6.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

13.3 Mutations KeyQuestions: 1)What are mutations? 2)How do mutations affect genes? The sequence of bases in DNA are like the letters of a coded message.

Gene Regulation and Mutation Notes and Questions How do mutations affect a cell?

Lesson Overview 13.3 Mutations. THINK ABOUT IT The sequence of bases in DNA are like the letters of a coded message. What would happen if a few of those.

Genetic Mutations Occur in any organism, from people and other animals to plants, bacteria, fungi, and protists. A mutation is any change in the nucleotide.

MUTATIONS Chapter 17. Mutation: Effects of changes to the genetic information of a cell or virus. Responsible for huge diversity of genes Source of new.

Protein synthesis continued.  Transcription is step 1  DNA  mRNA  Nucleus  RNA polymerase.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

The Cell Cycle.

MOLECULAR GENETICS Mutations Definition

Wild-type hemoglobin DNA Mutant hemoglobin DNA LE Wild-type hemoglobin DNA Mutant hemoglobin DNA 3¢ 5¢ 3¢ 5¢ mRNA mRNA 5¢ 3¢ 5¢ 3¢ Normal hemoglobin.

Gene Mutations.

GENETIC MUTATIONS Section 5.6 Pg. 259.

Types of Mutations.

Gene Mutations Chapter 11.

Gene Mutations.

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

11.3 Section Objectives – page 296

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Chapter 11.6 When it all goes Wrong

Mutations Section 12-4.

Changes in the nucleotide sequence of DNA or mRNA

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Distinguish between codon and anticodon.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

DNA Mutations Types & their effects.

Mutations: Changes in Genes

Presentation transcript:

NOTES – CH 17, part 2 DNA & MUTATIONS

MUTATIONS ● permanent changes in DNA that can involve large chromosomal regions or a single nucleotide pair

● 3 Types of Point Mutations: ● POINT MUTATION: mutation limited to about one or two nucleotides in a single gene ● 3 Types of Point Mutations: Base-pair substitution Base pair insertion Base pair deletion

1) Base-pair substitution: ● replacement of 1 nucleotide base pair with another resulting in little or no change in the protein encoded by the mutated gene -redundancy in the genetic code is why some substitutions have no effect; a base pair change may simply transform one codon into another that codes for the same amino acid.

-even if the substitution alters an amino acid, the new amino acid may have similar properties to the one it replaces, or it may be in a part of the protein where the exact amino acid sequence is not essential to its activity.

-some base pair substitutions result in readily detectable changes in proteins that may significantly alter protein activity (i.e. sickle cell anemia; 1 amino acid in hemoglobin is altered)

2) Base pair insertion: ● the insertion of 1 or more nucleotide pairs into a gene

3) Base pair deletion: ● the deletion of 1 or more nucleotide pairs from a gene -because mRNA is read as a series of triplets during translation, insertion or deletion of nucleotides may alter the “reading frame” of the genetic message

-this type of FRAMESHIFT MUTATION will occur whenever the number of nucleotides inserted or deleted is not 3 or a multiple of 3. -this type of mutation usually results in a nonfunctional protein (unless the mutation is very near the end of the gene)

FRAMESHIFT MUTATION:

Summary

MUTAGENS: ● MUTAGENS = physical or chemical agents that interact with DNA to cause mutations

MUTAGENS: ● most mutagens are also carcinogens ● CARCINOGEN = an agent that causes cancer

PHYSICAL MUTAGENS: ● x-rays ● UV radiation ● radioactivity

CHEMICAL MUTAGENS: ● base analogues (similar to normal DNA bases, but pair incorrectly) ● insert into DNA double helix & interfere with correct DNA replication ● cause chemical changes in the bases that change their pairing properties

CHEMICAL MUTAGENS: ● benzene (industrial solvent) ● DDT (& other pesticides) ● nitrogen mustard (in mustard gas, a chemical weapon)

CHEMICAL MUTAGENS: ● cigarette smoke! (contains 4000 chemicals, at least 43 of which are carcinogens!!!!) -nicotine, tar, carbon monoxide, formaldehyde, hydrogen cyanide, ammonia, arsenic, DDT