Regents Biology Mutations Changes to DNA
Regents Biology Mutations permanent change in a cell’s DNA sequence Includes changes in nucleotide sequence, alteration of gene position, gene loss, duplication, or insertion of foreign sequences Can be inherited if mutation is in gamete Most mutations have a negative effect Positive mutation? evolution
Regents Biology Mutagen Any agent that causes changes in DNA Includes physical agents that damage DNA X-rays UV rays Cigarette tar Gamma rays carcinogens
Regents Biology Mutant An organism carrying a gene that has mutated
Regents Biology Mutations Changes to DNA are called mutations change the DNA changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait
Regents Biology Classes of Mutations 1. Gene level Mutations include different point & frame-shift mutations 2. Chromosome level Rearrangement of genes within or between chromosomes
Regents Biology Gene Level Mutations Changes to the letters (A,C,T,G bases) in the DNA point mutation change to ONE letter (base) in the DNA may cause change to protein, may not frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!
Regents Biology Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN OR THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN Does this change the sentence? A LITTLE!
Regents Biology Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop Does this change the protein? DEPENDS…
Regents Biology Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids
Regents Biology AUGCGUGUAUACGCUUGCGAGUGA Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? Why not? The code has repeats in it!
Regents Biology AUGCGUGUAUAAGCAUGCGAGUGA Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop MetArgValStop Really destroyed that protein!
Regents Biology Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add one!Delete one! Does this change the sentence? A LOT!
Regents Biology Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA Does this change the protein? A LOT!
Regents Biology AUGCGUGUAUACGAUGCGAGUGA Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop MetArgValTyrAspAlaSerGA Does this change the protein? A LOT!
Regents Biology Cystic fibrosis Broken salt channel in cells strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; with treatment can live past their late 20s
Regents Biology Effect on Lungs Salt channel transports salt through protein channel out of cell Osmosis problems! airway salt H2OH2O H2OH2O normal lungs cystic fibrosis cells lining lungs salt channel normal mucus thick mucus mucus & bacteria build up = lung infections & damage
Regents Biology Deletion leads to Cystic fibrosis deletion Loss of one amino acid!
Regents Biology Chromosome Level Mutations Mutation involving a large segment of DNA 1. Translocation 2. Inversion 3. Deletions
Regents Biology Chromosome Level Mutations 1. Translocation Relocation of groups of base pairs from 1 chromosomes to another (usually occurs between homologous chromosomes) New proteins can result Eg. Some types of leukemia Transposable element – fragments of DNA that continue to move from 1 chromosomes to another (can disrupt transcription
Regents Biology Chromosome Level Mutations 1. Translocation 2. Inversion A sequence of DNA is inverted (reversed) ABC → CBA Can disrupt base pairing 3. Deletions
Regents Biology Chromosome Level Mutations 1. Translocation 2. Inversion 3. Deletions Involve loss of chromosomal material Eg. Cancer – results of mutation in genetic sequence
Regents Biology Not to ask questions is a mutation!