KIMBERLY JONES AUGUST 20, 2010 SPUR PROGRAM 2010 UNIVERSITY OF OREGON BERGLUND LAB INSTITUTE OF MOLECULAR BIOLOGY P.I.-ANDY BERGLUND, PHD MENTORS-AMY MAHADY, MS & DANIELLE CASS, PHD The Importance of the Linker Between Zinc Finger Sets in MBNL

Berglund Lab Studies Myotonic Dystrophy Most common adult onset form of muscular dystrophy Effects 1 in ~8000 people  Symptoms include:  Myopathy  Myotonia  Cataracts  Cardiac Arrhythmia  Etc. Myotonic Dystrophy Foundation, 2010

Genetic Basis of Myotonic Dystrophy DMPK pre-mRNA Muscleblind-like DMPK gene 3’ UTR (CTG) n Transcription Autosomal dominant genetic disorder caused by a CTG repeat in the 3’-UTR of the DMPK gene. This leads to a toxic, hairpin, CUG-repeat pre-mRNA which sequesters muscleblind-like (MBNL), a known regulator of alternative splicing. This is what likely gives rise to the characteristic symptoms. Ex.: Insulin Resistance due to insulin receptor misplicing Myotonia due to chloride ion channel misplicing Warf, 2009

MBNL and Mbl Structure MBNL Mbl Mbl (Muscleblind) is an MBNL orthologue in Droshophila (fruitfly). It consists of 2 zinc fingers in 1 domain. MBNL (Muscleblind-like) consists of 4 zinc fingers in 2 domains (ZnF1/2 and ZnF3/4) with a long, central linker between zinc finger domains.

Zinc Fingers Comprise the Binding Regions of Proteins in the Muscleblind Family Teplova M, Patel DJ. Figures 1 and 3. Diagrams. Structural insights into RNA recognition by the alternative-splicing regulator muscleblind-like MBNL1. Nature Structural & Molecular Biology. Dec. 2008; 15(12) p.1344 o Zinc Finger consists of 3 cysteines and 1 histidine coordinated around a zinc ion. o This holds the protein in a folded position to allow for proper RNA binding. o Two zinc fingers make up a domain, as ZnF1/2 and ZnF3/4. o Binding is facilitated by base stacking and hydrogen bonding interactions. o These proteins show YGCY RNA motif preference, where Y is a pyrimidine (either U or C).

Zinc Fingers are Highly Conserved Teplova M, Patel DJ. Figure 1. Diagrams. Structural insights into RNA recognition by the alternative-splicing regulator muscleblind-like MBNL1. Nature Structural & Molecular Biology. Dec. 2008; 15(12) p.1344 ZnF1 ZnF3 ZnF2 ZnF4

Not Much is Known about MBNL’s Central Linker MBNL Contains segments of conserved residues Not known to be structured Not known whether it contributes to RNA binding Voelker, amino acids

Conformation of MBNL/Mbl when Binding RNA The current model assumes that MBNL folds using its central linker anti-parallel to itself to bind RNAs that contain short U spacer segments between GC binding regions. This flexibility would also allow it to bind to RNAs with longer U spacer segments. Since Mbl only has one binding domain and no flexible linker region, it binds only to RNAs with longer U spacer regions between GC binding regions.

MBNL/Mbl Binding to Specific RNAs was Tested Previously the following RNAs were tested with MBNL and Mbl:  RNA 1: UUUUUUUUUGCUGCUUUUUUUUU  RNA 11: UUUUGCUUUUUUUUUUUGCUUUU  RNA 2GG: UUUGGUUUUUUUUUUUUUGGUUU

Binding of MBNL and Mbl MBNL and Mbl both bind RNA 11. MBNL binds RNA 1 very tightly, while Mbl binds it very loosely to not at all. However more data is needed for Mbl since the error is larger than the Kd. Both proteins show no binding to RNA 2GG, as expected for a negative control. MBNL Mbl Cass, 2010

If Mbl is doubled, will the resulting construct show similar binding behavior to MBNL, or will it require a longer central linker?  More specifically, will the doubled Mbl construct be able to bind RNAs that contain short U spacers between GC binding regions with or without the longer central linker? Experimental Question

Experimental Approach Make and purify 2 protein constructs using Mbl:  2xMbl: Double Mbl  2xMbl-HL: Double Mbl plus a portion of human MBNL central linker Run binding gel shift assays using 3 different RNAs  RNA 1: UUUUUUUUUGCUGCUUUUUUUUU  RNA 11: UUUUGCUUUUUUUUUUUGCUUUU  RNA 2GG: UUUGGUUUUUUUUUUUUUGGUUU Calculate the Kds of each protein for each RNA

Protein and RNA Constructs 2xMbl2xMbl-HL Proteins: RNAs: RNA 1: U 9 GC U GC U 9 Single U spacer between GC binding sites RNA 11: U 4 GC U 11 GC U 4 Eleven U’s spacer between GC binding sites RNA 2GG: U 3 GG U 13 GG U 3 GC changed to GG for negative control Linker taken from center of human MBNL central linker. 52 amino acids 104 amino acids

Purified Proteins kDa Mbl ~11.9kDa MBNL ~28.4kDa 2xMbl ~24kDa 2xMbl-HL~29.2kDa MBNL Mbl 2xMbl 2xMbl-HL kDa Protein Ladder kDa Protein Ladder Contamination?

Predictions of Binding Behavior Since 2xMbl has double the number of zinc fingers (binding sites) as Mbl, it should show stronger binding than Mbl to both RNA 11 and 1. However, it should show less binding than MBNL. 2xMbl-HL contains double the zinc fingers like 2xMbl but also contains a longer central linker, thus it should bind stronger than 2xMbl and more similarly to MBNL for both RNA 11 and 1. Note: This assumes that ZnF1/2 acts similarly to ZnF3/4.

Results: Binding Gel Shifts 2xMbl Protein Concentration: 0-1.2µM 11: 0.2nM1: 0.2nM2GG: 0.2nM 2xMbl-HL 1: 0.3nM11: 0.3nM2GG: 0.3nM µM RNA 11: U 4 GC U 10 GC U 4 RNA 1: U 9 GC U GC U 9 RNA 2GG: U 3 GG U 13 GG U 3 Free RNA Protein:RNA Complex Protein:RNA Complex

Deriving the Dissociation Constant (Kd) Kd equation A dissociation constant (Kd) is a measure of equilibrium of how likely a complex is to dissociate into separate parts. This tells us how tightly the protein binds to the RNA. The lower the Kd, the tighter the protein binds to the RNA and vice versa.

Results: Dissociation Constants (Kds) MBNL Mbl 2xMbl 2xMbl-HL 2xMbl-HL shows tighter binding to RNA 11 than MBNL, while 2xMbl binds weaker. But more data is needed to confirm its results due to the error being larger than the actual Kd. 2xMbl-HL shows similar binding to RNA 1 as MBNL. 2xMbl binds more strongly to RNA1 than Mbl; however more data is needed to confirm results due to the error being larger than the actual Kd for Mbl. All proteins showed no binding to RNA 2GG, as expected for a negative control.

Conclusions Both 2xMbl and 2xMbl-HL bind RNA 11 and RNA 1. o More data is needed for 2xMbl on RNA 11 due to larger error than Kd. This is also the case for Mbl on RNA 1. The data show that the 52 amino acid linker in 2xMbl is sufficient for binding to short U spacer RNA 1. The central linker seems to play an important role, with increased length giving increased binding affinity. The tighter binding of 2xMbl-HL to both RNAs seems to support the binding model for MBNL described already. ZnF1/2 appears to act similarly to ZnF3/4.

Future Directions/Current Work Work with other RNAs to further determine sequence specificity of binding sites in 2xMbl and 2xMbl-HL. Mutate MBNL portion of central linker in 2xMbl-HL, specifically the most conserved residues to determine if the sequence of the linker is important for increasing the binding affinity. 2xMbl 2xMbl-HL

Acknowledgements Berglund Lab  Andy Berglund, PhD-P.I.  Amy Mahady, MS-Mentor  Danielle Cass, PhD-Mentor  Paul Barber-Former Mentor  Jamie  Rodger  Julia  Leslie  Devika  Julien  Elaine  Alex  Brandi  Phil SPUR Program & the University of Oregon  Peter O’Day  Blakely Strand

Questions? ? ? ? ? ? ? ?? ? ?

Portion of MBNL central linker in 2xMbl-HL MBNL Linker Portion in 2xMbl-HL

The Central Linker is only Partly Conserved

Data for Kd Results 2xMBL2xMBL-L RNAKd 1Kd 2Kd 3AvgStd Dev Relative to 2GCRNAKd 1Kd 2Kd 3Kd 4AvgStd Dev Relative to 2Gc NV NV NV NV GC GC GGNB 2GGNB 2GC GC NVCNQ NVC NVA4NQ NVA GGCGNB 2GGCG xAGCA xCGCC MBLMBNL RNAKd 1Kd 2Kd 3AvgStd Dev Relative to 2GcRNAKd 1Kd 2Kd 3Kd 4Avg Relative to 2GC NV NV #DIV/0! NV NV #DIV/0! 1GC GC #DIV/0! 2GGNB 2GGNB 2GC #DIV/0!12GC#DIV/0! NVC #DIV/0! NVC #DIV/0! NVA #DIV/0! NVA #DIV/0! 2GGCG #DIV/0! GGCG35.291#DIV/0! 2xAGCA xAGCA #DIV/0! 2xCGCC xCGCC #DIV/0!